p2rx3a

Ensembl ID:
ENSDARG00000010477
ZFIN ID:
ZDB-GENE-000427-3
Description:
purinergic receptor P2X3 [Source:RefSeq peptide;Acc:NP_571698]
Human Orthologue:
P2RX3
Human Description:
purinergic receptor P2X, ligand-gated ion channel, 3 [Source:HGNC Symbol;Acc:8534]
Mouse Orthologue:
P2rx3
Mouse Description:
purinergic receptor P2X, ligand-gated ion channel, 3 Gene [Source:MGI Symbol;Acc:MGI:1097160]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22465 Nonsense Available for shipment Available now
sa45513 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa22465
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021417 Nonsense 10 410 1 12
Genomic Location (Zv9):
Chromosome 14 (position 22962871)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 21662359
GRCz11 14 21959604
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTAAGCTACACAAACTTCTACTATGGCTCCCAGAGTGCTGGGCTTCATC[A/T]AAGGGTTCTTCGTCTATGAAACCGCCAAGTCTGTAGTAGTGAAGAGCTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45513
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021417 Nonsense 384 410 12 12
Genomic Location (Zv9):
Chromosome 14 (position 22948003)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 21647491
GRCz11 14 21944736
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCTTCAGGTATCAGGCTTTGTGCCTGAGTCTGGAAGCAACATACTCTA[C/A]AAGGGCAGCCAGGTGTCGATCAAAGCACTGGAGAAGAACTCTAATGACTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link