Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
rnf11
- Ensembl ID:
- ENSDARG00000010442
- ZFIN ID:
- ZDB-GENE-040426-1277
- Description:
- ring finger protein 11 [Source:RefSeq peptide;Acc:NP_957315]
- Human Orthologue:
- RNF11
- Human Description:
- ring finger protein 11 [Source:HGNC Symbol;Acc:10056]
- Mouse Orthologue:
- Rnf11
- Mouse Description:
- ring finger protein 11 Gene [Source:MGI Symbol;Acc:MGI:1352759]
Alleles
There is 1 allele of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa32771 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa32771
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000018817 | Nonsense | 121 | 146 | 3 | 3 |
The following transcripts of ENSDARG00000010442 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 1 (position 52630135)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 1 51501084 GRCz11 1 52135209 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CGGTTCCTGCCCTGCATGCACATCTATCACGTGGACTGCATCGATGCCTG[G/A]CTCATGCGCTCCTTCACTTGCCCCTCCTGTATGGAGCCGGTGGATGCTGC
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Ventricular conduction: Common variants in 22 loci are associated with QRS duration and cardiac ventricular conduction. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
