
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
fam46c
- Ensembl ID:
- ENSDARG00000010437
- ZFIN ID:
- ZDB-GENE-030131-5365
- Description:
- Protein FAM46C [Source:UniProtKB/Swiss-Prot;Acc:Q7ZUP1]
- Human Orthologue:
- FAM46C
- Human Description:
- family with sequence similarity 46, member C [Source:HGNC Symbol;Acc:24712]
- Mouse Orthologue:
- Fam46c
- Mouse Description:
- family with sequence similarity 46, member C Gene [Source:MGI Symbol;Acc:MGI:1921895]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa44703 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa38733 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa44703
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000023572 | Nonsense | 373 | 388 | 2 | 2 |
ENSDART00000032307 | None | 107 | None | 3 | |
ENSDART00000139174 | Nonsense | 376 | 391 | 2 | 2 |
ENSDART00000142787 | None | 278 | None | 2 |
- Genomic Location (Zv9):
- Chromosome 9 (position 21816877)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 9 20972663 GRCz11 9 20783532 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TACTACCAGCCGGCTCCGTATGTCAAAGACCTGAACTTCAACAACTACTA[T/A]GTGGCCTCTTGTAACCAGTCCATTCCAACTTGGTTGCCGTGTAACTAAGA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa38733
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000023572 | Nonsense | 387 | 388 | 2 | 2 |
ENSDART00000032307 | None | 107 | None | 3 | |
ENSDART00000139174 | Nonsense | 390 | 391 | 2 | 2 |
ENSDART00000142787 | None | 278 | None | 2 |
- Genomic Location (Zv9):
- Chromosome 9 (position 21816919)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 9 20972705 GRCz11 9 20783574 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AACTACTATGTGGCCTCTTGTAACCAGTCCATTCCAACTTGGTTGCCGTG[T/A]AACTAAGACACAAAGGATGCTTATTTGAAGACTAAATCCATCAGTTGGTC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: