si:dkey-49h9.6
- Ensembl ID:
- ENSDARG00000010408
- ZFIN ID:
- ZDB-GENE-060810-28
- Description:
- Si:dkey-49h9.6 protein [Source:UniProtKB/TrEMBL;Acc:Q58EE5]
- Human Orthologue:
- IGSF9
- Human Description:
- immunoglobulin superfamily, member 9 [Source:HGNC Symbol;Acc:18132]
- Mouse Orthologue:
- Igsf9
- Mouse Description:
- immunoglobulin superfamily, member 9 Gene [Source:MGI Symbol;Acc:MGI:2135283]
Alleles
There are 11 alleles of this gene:
Allele name |
Consequence |
Status |
Availability Estimate |
sa16569 |
Essential Splice Site |
Available for shipment |
Available now |
sa34288 |
Essential Splice Site |
Mutation detected in F1 DNA |
During 2018 |
sa41110 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa34287 |
Nonsense |
Available for shipment |
Available now |
sa31628 |
Essential Splice Site |
Available for shipment |
Available now |
sa17849 |
Nonsense |
Available for shipment |
Available now |
sa21186 |
Nonsense |
Available for shipment |
Available now |
sa21185 |
Nonsense |
Available for shipment |
Available now |
sa38664 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa13287 |
Nonsense |
Available for shipment |
Available now |
sa1149 |
Nonsense |
Available for shipment |
Available now |
Mutation Details
- Allele Name:
- sa16569
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- T > A
- Consequence:
- Essential Splice Site
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000004986 |
Essential Splice Site |
276 |
2021 |
6 |
21 |
ENSDART00000126808 |
Essential Splice Site |
187 |
1919 |
4 |
18 |
- Genomic Location (Zv9):
- Chromosome 8 (position 5091566)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
8 |
4826758 |
GRCz11 |
8 |
4883025 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- ACCTCACGTATGAGTGGTGGAAACAAGGACAAAACGTGYATCACATTGAG[T/A]AAGTGACCTACGAYTACTAACACAAGGCATATACAACATYATCACACAGA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa34288
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000004986 |
Essential Splice Site |
373 |
2021 |
9 |
21 |
ENSDART00000126808 |
Essential Splice Site |
271 |
1919 |
7 |
18 |
- Genomic Location (Zv9):
- Chromosome 8 (position 5086169)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
8 |
4821361 |
GRCz11 |
8 |
4877628 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTAATCATCAGGCATGTCATGATTTTTTTATTCCTCATCTTGATTGGACA[G/A]TATCCAGGATGGATGGTCAACTCGGAGGGATCTGTGTTCATTACTGCTGC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa41110
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- T > G
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 8 (position 5077611)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
8 |
4812803 |
GRCz11 |
8 |
4869070 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ACTTGATATTTTTTGCATTTCAGCACCTCCAACAGAATCTCCTACTGTGT[T/G]AACCACCATGGCAGTGTTGTCTCCTCCCACATTGCTGTCAGCCAACCGTA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa34287
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 8 (position 5077540)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
8 |
4812732 |
GRCz11 |
8 |
4868999 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CTCCTCCCACATTGCTGTCAGCCAACCGTACATCACTGGGTGTGTTGCTG[C/T]AGTGGGTCCCACCTCTAGAAGAGTCGTTAACTTCCTTTGCACTTCAAGCA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa31628
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
- Mutation:
- T > G
- Consequence:
- Essential Splice Site
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000004986 |
Essential Splice Site |
780 |
2021 |
17 |
21 |
ENSDART00000126808 |
Essential Splice Site |
678 |
1919 |
15 |
18 |
- Genomic Location (Zv9):
- Chromosome 8 (position 5071773)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
8 |
4806965 |
GRCz11 |
8 |
4863232 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CCCACCTTTCAGATATCCCCTCTGCCTTCCAGAAGAGTTCAGCTCCACAG[T/G]AAGTGTCCATCCTTGCTATGCATGCATCATTACTATGCTTCTCTATCTTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa17849
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- T > A
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 8 (position 5069117)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
8 |
4804309 |
GRCz11 |
8 |
4860576 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- GATGATGAGMAYGGTGGCTCTGAGGCCTTATTGGAAAGGGCCAGCTTTTA[T/A]TCTGACTGTAGTGAAAAGAAAGCAAGTGACTCGCWAAAAAAATACCGGGG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa21186
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
- Mutation:
- C > A
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 8 (position 5068515)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
8 |
4803707 |
GRCz11 |
8 |
4859974 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TACCAGCCTGGTGCCAGTGCAAAGCCTTTCTGAAGGAAACACACCTCACT[C/A]ACTTTACCCAAACATGCGTCAACAAGCCATTCCCAATGTAGAAGGTTCAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa21185
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
- Mutation:
- C > A
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 8 (position 5067540)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
8 |
4802732 |
GRCz11 |
8 |
4858999 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CCACGGCACACAGAATGTTCCCATGGAAAAACCTAAACCTGAGGACATCT[C/A]AGAACCACTTCCGCAATTAGAAGCAAGAGATAGATGTGTTAAATCAGGAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa38664
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 8 (position 5067295)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
8 |
4802487 |
GRCz11 |
8 |
4858754 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GCATGGCAGCGATAGTTTCCAAATGCCCAGACTTTATATCTCAACAATAT[C/T]AAAGACCTCAGATTCACAGTGACAGTACCAACATGATATCCTCACGAATC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa13287
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- T > A
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 8 (position 5067098)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
8 |
4802290 |
GRCz11 |
8 |
4858557 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- TCCATTAGTTTAGGATCAAGATATGAACATTCAGAACTTCCRAGACCTTA[T/A]TTCTCTGAGACGTGCTACAGAGATCARTTTCCCAACCCAGATATAAGGCT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa1149
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 8 (position 5066875)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
8 |
4802067 |
GRCz11 |
8 |
4858334 |
- KASP Assay ID:
- 554-1060.1 (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- GATCTGGAATGACACCACCTTACCAAACAACCTTTGTCCCAAATCCTTCA[C/T]GACAGATGGAACCATCCCTTCCTTCTAGGCGGGAATCAGATCCACGTCGA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes
(for example, a new allele is generated or an allele is made available
for distribution) then please enter your details below: