si:dkey-49h9.6

Ensembl ID:
ENSDARG00000010408
ZFIN ID:
ZDB-GENE-060810-28
Description:
Si:dkey-49h9.6 protein [Source:UniProtKB/TrEMBL;Acc:Q58EE5]
Human Orthologue:
IGSF9
Human Description:
immunoglobulin superfamily, member 9 [Source:HGNC Symbol;Acc:18132]
Mouse Orthologue:
Igsf9
Mouse Description:
immunoglobulin superfamily, member 9 Gene [Source:MGI Symbol;Acc:MGI:2135283]

Alleles

There are 11 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16569 Essential Splice Site Available for shipment Available now
sa34288 Essential Splice Site Mutation detected in F1 DNA During 2018
sa41110 Nonsense Mutation detected in F1 DNA During 2018
sa34287 Nonsense Available for shipment Available now
sa31628 Essential Splice Site Available for shipment Available now
sa17849 Nonsense Available for shipment Available now
sa21186 Nonsense Available for shipment Available now
sa21185 Nonsense Available for shipment Available now
sa38664 Nonsense Mutation detected in F1 DNA During 2018
sa13287 Nonsense Available for shipment Available now
sa1149 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16569
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004986 Essential Splice Site 276 2021 6 21
ENSDART00000126808 Essential Splice Site 187 1919 4 18
Genomic Location (Zv9):
Chromosome 8 (position 5091566)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 4826758
GRCz11 8 4883025
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCTCACGTATGAGTGGTGGAAACAAGGACAAAACGTGYATCACATTGAG[T/A]AAGTGACCTACGAYTACTAACACAAGGCATATACAACATYATCACACAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34288
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004986 Essential Splice Site 373 2021 9 21
ENSDART00000126808 Essential Splice Site 271 1919 7 18
Genomic Location (Zv9):
Chromosome 8 (position 5086169)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 4821361
GRCz11 8 4877628
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAATCATCAGGCATGTCATGATTTTTTTATTCCTCATCTTGATTGGACA[G/A]TATCCAGGATGGATGGTCAACTCGGAGGGATCTGTGTTCATTACTGCTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41110
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004986 Nonsense 614 2021 14 21
ENSDART00000126808 Nonsense 512 1919 12 18
Genomic Location (Zv9):
Chromosome 8 (position 5077611)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 4812803
GRCz11 8 4869070
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTTGATATTTTTTGCATTTCAGCACCTCCAACAGAATCTCCTACTGTGT[T/G]AACCACCATGGCAGTGTTGTCTCCTCCCACATTGCTGTCAGCCAACCGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34287
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004986 Nonsense 638 2021 14 21
ENSDART00000126808 Nonsense 536 1919 12 18
Genomic Location (Zv9):
Chromosome 8 (position 5077540)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 4812732
GRCz11 8 4868999
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCCTCCCACATTGCTGTCAGCCAACCGTACATCACTGGGTGTGTTGCTG[C/T]AGTGGGTCCCACCTCTAGAAGAGTCGTTAACTTCCTTTGCACTTCAAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31628
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004986 Essential Splice Site 780 2021 17 21
ENSDART00000126808 Essential Splice Site 678 1919 15 18
Genomic Location (Zv9):
Chromosome 8 (position 5071773)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 4806965
GRCz11 8 4863232
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCACCTTTCAGATATCCCCTCTGCCTTCCAGAAGAGTTCAGCTCCACAG[T/G]AAGTGTCCATCCTTGCTATGCATGCATCATTACTATGCTTCTCTATCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17849
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004986 Nonsense 976 2021 18 21
ENSDART00000126808 Nonsense 874 1919 16 18
Genomic Location (Zv9):
Chromosome 8 (position 5069117)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 4804309
GRCz11 8 4860576
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATGATGAGMAYGGTGGCTCTGAGGCCTTATTGGAAAGGGCCAGCTTTTA[T/A]TCTGACTGTAGTGAAAAGAAAGCAAGTGACTCGCWAAAAAAATACCGGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21186
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004986 Nonsense 1177 2021 18 21
ENSDART00000126808 Nonsense 1075 1919 16 18
Genomic Location (Zv9):
Chromosome 8 (position 5068515)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 4803707
GRCz11 8 4859974
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACCAGCCTGGTGCCAGTGCAAAGCCTTTCTGAAGGAAACACACCTCACT[C/A]ACTTTACCCAAACATGCGTCAACAAGCCATTCCCAATGTAGAAGGTTCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21185
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004986 Nonsense 1502 2021 18 21
ENSDART00000126808 Nonsense 1400 1919 16 18
Genomic Location (Zv9):
Chromosome 8 (position 5067540)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 4802732
GRCz11 8 4858999
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCACGGCACACAGAATGTTCCCATGGAAAAACCTAAACCTGAGGACATCT[C/A]AGAACCACTTCCGCAATTAGAAGCAAGAGATAGATGTGTTAAATCAGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38664
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004986 Nonsense 1584 2021 18 21
ENSDART00000126808 Nonsense 1482 1919 16 18
Genomic Location (Zv9):
Chromosome 8 (position 5067295)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 4802487
GRCz11 8 4858754
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCATGGCAGCGATAGTTTCCAAATGCCCAGACTTTATATCTCAACAATAT[C/T]AAAGACCTCAGATTCACAGTGACAGTACCAACATGATATCCTCACGAATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13287
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004986 Nonsense 1649 2021 18 21
ENSDART00000126808 Nonsense 1547 1919 16 18
Genomic Location (Zv9):
Chromosome 8 (position 5067098)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 4802290
GRCz11 8 4858557
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCATTAGTTTAGGATCAAGATATGAACATTCAGAACTTCCRAGACCTTA[T/A]TTCTCTGAGACGTGCTACAGAGATCARTTTCCCAACCCAGATATAAGGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1149
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004986 Nonsense 1724 2021 18 21
ENSDART00000126808 Nonsense 1622 1919 16 18
Genomic Location (Zv9):
Chromosome 8 (position 5066875)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 4802067
GRCz11 8 4858334
KASP Assay ID:
554-1060.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATCTGGAATGACACCACCTTACCAAACAACCTTTGTCCCAAATCCTTCA[C/T]GACAGATGGAACCATCCCTTCCTTCTAGGCGGGAATCAGATCCACGTCGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link