c1ql3a

Ensembl ID:
ENSDARG00000010350
ZFIN ID:
ZDB-GENE-080417-1
Description:
SI:dZ63M2.2 (Novel protein similar to human gliacolin) [Source:UniProtKB/TrEMBL;Acc:Q7ZZ82]
Human Orthologue:
C1QL3
Human Description:
complement component 1, q subcomponent-like 3 [Source:HGNC Symbol;Acc:19359]
Mouse Orthologue:
C1ql3
Mouse Description:
C1q-like 3 Gene [Source:MGI Symbol;Acc:MGI:2387350]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa45835 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45835
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016879 Essential Splice Site 201 258 2 2
Genomic Location (Zv9):
Chromosome 24 (position 33145880)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 32003470
GRCz11 24 31940681
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATATACAGCTGGAACGATGCACTAAATGTAGTTGTCTCGTCCCGCAGGT[G/A]CGTGCCAGTGCCATCGCCCAGGACGCAGATCAAAACTACGACTACGCCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link