zgc:56231

Ensembl ID:
ENSDARG00000010332
ZFIN ID:
ZDB-GENE-040426-1914
Description:
kinesin-like protein KIF20A [Source:RefSeq peptide;Acc:NP_998353]
Human Orthologue:
KIF20A
Human Description:
kinesin family member 20A [Source:HGNC Symbol;Acc:9787]
Mouse Orthologue:
Kif20a
Mouse Description:
kinesin family member 20A Gene [Source:MGI Symbol;Acc:MGI:1201682]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41054 Nonsense Mutation detected in F1 DNA During 2018
sa13283 Nonsense Available for shipment Available now
sa38646 Essential Splice Site Mutation detected in F1 DNA During 2018
sa21104 Essential Splice Site Available for shipment Available now
sa38647 Nonsense Mutation detected in F1 DNA During 2018
sa15763 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa41054
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024185 Nonsense 155 810 4 18
Genomic Location (Zv9):
Chromosome 7 (position 59997768)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 58450206
GRCz11 7 58752646
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAAATGCATTAGTGTTCAGTTATGGAGTGACCAATGCTGGAAAAACATA[C/A]ACAATACAAGGTAAACATGGACATCCACAAAATTTGCTATTTTGGGGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13283
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024185 Nonsense 289 810 7 18
Genomic Location (Zv9):
Chromosome 7 (position 59998923)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 58451361
GRCz11 7 58753801
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAATCTRCAATGAGCATGTGTATGACCTGCTTCAGCCAGCCCAGTCCAGC[A/T]AAACCAAACGACGTGCTGCACTGAGGGTTTGTGAGGACAGTACAGGGAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38646
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024185 Essential Splice Site 368 810 9 18
Genomic Location (Zv9):
Chromosome 7 (position 59999363)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 58451801
GRCz11 7 58754241
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCATCAAACTGATACGCATTGAAGGAGCAGACGTTCAAGCATTGTCAGAG[T/A]AAGTGGAAAGAGCGCATTATTTGTAACGCATGTAGTTTTGTAAGTGTAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21104
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024185 Essential Splice Site 530 810 12 18
Genomic Location (Zv9):
Chromosome 7 (position 60001453)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 58453884
GRCz11 7 58756314
KASP Assay ID:
2259-9633.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAGCTGCTGGATGGAGATGAGGCAGATATGTCCATATTACCCCAAGAGG[T/A]AATTTATTGCTTTGGTTGAACACTTGCATTAGTCATGACATTGAGAATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38647
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024185 Nonsense 717 810 17 18
Genomic Location (Zv9):
Chromosome 7 (position 60002532)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 58454963
GRCz11 7 58757393
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGCGGATAGGAGAGTTGAATGATACTCTGCAAGAAGCGGGGGAGAGTTA[T/A]ATGGAAAAACTTGCAGAAGTTCAAAATCTGCAAAACAGGCTATCAACTCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15763
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024185 Essential Splice Site 734 810 17 18
Genomic Location (Zv9):
Chromosome 7 (position 60002584)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 58455015
GRCz11 7 58757445
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGAAAAACTTGCAGAAGTTCAAAATCTGCAAAACAGGCTATCAACTCGG[G/T]TAAGAATGCATGCAAGTAACTTTGTTTGGCTATGTGCTTGTTATGAACGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link