srpx

Ensembl ID:
ENSDARG00000010318
ZFIN ID:
ZDB-GENE-050327-43
Description:
sushi-repeat-containing protein [Source:RefSeq peptide;Acc:NP_001014348]
Human Orthologue:
SRPX
Human Description:
sushi-repeat-containing protein, X-linked [Source:HGNC Symbol;Acc:11309]
Mouse Orthologue:
Srpx
Mouse Description:
sushi-repeat-containing protein Gene [Source:MGI Symbol;Acc:MGI:1858306]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa21508 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa21508
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026551 Essential Splice Site 162 448 None 10

The following transcripts of ENSDARG00000010318 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 31339840)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 30495786
GRCz11 9 30306532
KASP Assay ID:
2260-1982.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCTGCCAAAGCAGCAGAACATGGAGCGGCGGCAACAGCGTGTGCAATGG[T/A]AAGCCAAAGCTAAAGATGGAAAAGTGTAGTTACGCCCAATTTTTTGACTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link