si:dkey-31j12.4

Ensembl ID:
ENSDARG00000010294
ZFIN ID:
ZDB-GENE-080327-28
Description:
Novel protein similar to vertebrate fibromodulin (FMOD) [Source:UniProtKB/TrEMBL;Acc:B0UYH4]
Human Orthologue:
FMOD
Human Description:
fibromodulin [Source:HGNC Symbol;Acc:3774]
Mouse Orthologue:
Fmod
Mouse Description:
fibromodulin Gene [Source:MGI Symbol;Acc:MGI:1328364]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21346 Splice Site, Nonsense Available for shipment Available now
sa34454 Essential Splice Site Mutation detected in F1 DNA During 2018
sa21347 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21346
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019822 Splice Site, Nonsense 52 418 2 3
ENSDART00000141516   None 362 None 2
Genomic Location (Zv9):
Chromosome 8 (position 38601631)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 37457046
GRCz11 8 37489480
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATTAACATACATTTTATCATAAAGATATTTATATTTGTGTTCTGACAGG[A/T]AACCTGCAGTGAAAATGAGAGGCTGGATTTTACTGCTGATCCTGGCAAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34454
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019822 Essential Splice Site 368 418 2 3
ENSDART00000141516 Essential Splice Site 312 362 1 2
Genomic Location (Zv9):
Chromosome 8 (position 38602583)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 37457998
GRCz11 8 37490432
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATCAGCACCAGCCTAGAGAATCTGTATCTCCAGGCCAACAAGATCAAAG[G/A]TACAGAGAAATTATTTGAAATGTTAAGCAAATGTCATAGGGCATGTCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21347
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019822 Nonsense 400 418 3 3
ENSDART00000141516 Nonsense 344 362 2 2
Genomic Location (Zv9):
Chromosome 8 (position 38607878)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 37463293
GRCz11 8 37495727
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTATTCTAACCTGCGTGTACTGCGACTGGAGGCCAATGAAATTACCCCA[C/T]GAGATATACCCAATGAAGCGGTTCTCTGTCTGCGCCTGGCAACCAACATC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link