stx12

Ensembl ID:
ENSDARG00000010290
ZFIN ID:
ZDB-GENE-040625-11
Description:
syntaxin-12 [Source:RefSeq peptide;Acc:NP_001002051]
Human Orthologue:
STX12
Human Description:
syntaxin 12 [Source:HGNC Symbol;Acc:11430]
Mouse Orthologue:
Stx12
Mouse Description:
syntaxin 12 Gene [Source:MGI Symbol;Acc:MGI:1931027]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5926 Essential Splice Site, Splice Site Mutation detected in F1 DNA During 2018
sa23543 Nonsense Available for shipment Available now
sa4815 Essential Splice Site F2 line generated During 2018

Mutation Details

Allele Name:
sa5926
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site, Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041578 Splice Site None 267 None 10
ENSDART00000127165 Essential Splice Site None 267 2 10

The following transcripts of ENSDARG00000010290 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 30370492)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 14057118
GRCz11 19 13919313
KASP Assay ID:
554-3962.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTCAGTTTTTTCCATGTCCTGTGTATCTTCTGACAGTGTTTCTCTGCTC[T/C]CAGCATTTWCAGGCGCTGGTWGGCTTCCTGCTGTAGTTTGCTCCACCCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23543
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041578 Nonsense 235 267 9 10
ENSDART00000127165 Nonsense 235 267 9 10

The following transcripts of ENSDARG00000010290 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 30359055)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 14045681
GRCz11 19 13907876
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGCAGAAGTGCATGTGGAGAGAGGAGCTGAGCAGCTTCAGAGAGCTGCA[C/T]AATATCAGGTACAGTAAGAGTTTCAGCATCATACAAACACAGCTATAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4815
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041578 Essential Splice Site 237 267 9 10
ENSDART00000127165 Essential Splice Site 237 267 9 10

The following transcripts of ENSDARG00000010290 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 30359045)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 14045671
GRCz11 19 13907866
KASP Assay ID:
554-3508.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCATGTGGAGAGAGGAGCTGAGCAGCTTCAGAGAGCTGCACAATATCAGG[T/C]ACAGTAAGAGTTTCAGCATCATACAAACACAGCTATAAWGGTTCATACTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link