
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
dpyd
- Ensembl ID:
- ENSDARG00000010267
- ZFIN ID:
- ZDB-GENE-040426-2459
- Description:
- Dihydropyrimidine dehydrogenase [NADP+] [Source:UniProtKB/Swiss-Prot;Acc:Q6NYG8]
- Human Orthologue:
- DPYD
- Human Description:
- dihydropyrimidine dehydrogenase [Source:HGNC Symbol;Acc:3012]
- Mouse Orthologue:
- Dpyd
- Mouse Description:
- dihydropyrimidine dehydrogenase Gene [Source:MGI Symbol;Acc:MGI:2139667]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa17210 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa17210
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000100133 | Essential Splice Site | 37 | 739 | 1 | 15 |
ENSDART00000124724 | Essential Splice Site | 270 | 974 | 7 | 21 |
- Genomic Location (Zv9):
- Chromosome 2 (position 18050390)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 2 20361436 GRCz11 2 20019585 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TACACATCAAAGGATTTCCTTCCTTTGGTTGCAAAAGCCAGTAAAATAGG[T/A]ATTGAAGAAGAGAGACAAAATCCTTTCANNATGGKGCAATGTAAAAAAAA
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Autism spectrum disorder, attention deficit-hyperactivity disorder, bipolar disorder, major depressive disorder, and schizophrenia (combined): Identification of risk loci with shared effects on five major psychiatric disorders: a genome-wide analysis. (View Study)
- Platelet counts: Duffy-null-associated low neutrophil counts influence HIV-1 susceptibility in high-risk South African black women. (View Study)
- Schizophrenia: Genome-wide association study in a Swedish population yields support for greater CNV and MHC involvement in schizophrenia compared with bipolar disorder. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
OMIM
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: