zgc:100930

Ensembl ID:
ENSDARG00000010248
ZFIN ID:
ZDB-GENE-040801-151
Description:
WD repeat-containing protein 54 [Source:RefSeq peptide;Acc:NP_001003630]
Human Orthologue:
WDR54
Human Description:
WD repeat domain 54 [Source:HGNC Symbol;Acc:25770]
Mouse Orthologue:
Wdr54
Mouse Description:
WD repeat domain 54 Gene [Source:MGI Symbol;Acc:MGI:1922909]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38497 Essential Splice Site Mutation detected in F1 DNA During 2018
sa40536 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa38497
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026020 Essential Splice Site 119 336 4 10
Genomic Location (Zv9):
Chromosome 5 (position 44695321)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 42476586
GRCz11 5 43076739
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTATTATGGTCTATTGGCATGCACTGGAAACACCAGAGACGCCTACTGG[T/G]CAGTGCACATCACTGCATCTCCGTAAATCATAAACCTGTTCATTCCTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40536
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026020 Essential Splice Site 214 336 7 10
Genomic Location (Zv9):
Chromosome 5 (position 44695961)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 42477226
GRCz11 5 43077379
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGAAATCCGGAGAAGATTTTCAACTGCTGAACAAGATCCCTGGTTTTGA[G/T]TAAGTTTCGTTCATGAAAATTTGTGAAAATATAATGTTTCAATAATAATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link