
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:100930
- Ensembl ID:
- ENSDARG00000010248
- ZFIN ID:
- ZDB-GENE-040801-151
- Description:
- WD repeat-containing protein 54 [Source:RefSeq peptide;Acc:NP_001003630]
- Human Orthologue:
- WDR54
- Human Description:
- WD repeat domain 54 [Source:HGNC Symbol;Acc:25770]
- Mouse Orthologue:
- Wdr54
- Mouse Description:
- WD repeat domain 54 Gene [Source:MGI Symbol;Acc:MGI:1922909]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa38497 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa40536 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa38497
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > G
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000026020 | Essential Splice Site | 119 | 336 | 4 | 10 |
- Genomic Location (Zv9):
- Chromosome 5 (position 44695321)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 42476586 GRCz11 5 43076739 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCTATTATGGTCTATTGGCATGCACTGGAAACACCAGAGACGCCTACTGG[T/G]CAGTGCACATCACTGCATCTCCGTAAATCATAAACCTGTTCATTCCTTCA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa40536
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > T
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000026020 | Essential Splice Site | 214 | 336 | 7 | 10 |
- Genomic Location (Zv9):
- Chromosome 5 (position 44695961)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 42477226 GRCz11 5 43077379 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGGAAATCCGGAGAAGATTTTCAACTGCTGAACAAGATCCCTGGTTTTGA[G/T]TAAGTTTCGTTCATGAAAATTTGTGAAAATATAATGTTTCAATAATAATT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: