zgc:73371

Ensembl ID:
ENSDARG00000010231
ZFIN ID:
ZDB-GENE-040426-2731
Description:
hypothetical protein LOC405817 [Source:RefSeq peptide;Acc:NP_998046]
Human Orthologue:
PPM1N
Human Description:
protein phosphatase, Mg2+/Mn2+ dependent, 1N (putative) [Source:HGNC Symbol;Acc:26845]
Mouse Orthologue:
Ppm1n
Mouse Description:
protein phosphatase, Mg2+/Mn2+ dependent, 1N (putative) Gene [Source:MGI Symbol;Acc:MGI:2142330]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2809 Nonsense F2 line generated During 2018
sa22593 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa2809
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012039 Nonsense 84 433 1 6
Genomic Location (Zv9):
Chromosome 15 (position 9189003)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 9077616
GRCz11 15 9053687
KASP Assay ID:
554-3019.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGGAGTCCAAATGGGGCATTACCTACGCCATGGCCAGYATGCAAGGCTG[G/A]CGAGCACAGATGGAGGATTCCCACACTTGCATGCCAGAGATGAGCGATGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22593
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012039 Nonsense 170 433 2 6
Genomic Location (Zv9):
Chromosome 15 (position 9192558)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 9081171
GRCz11 15 9057242
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTCCTCGCCATCGACCGCCACATGCACACCCTGTCCCGTAATGAAAGCT[G/A]GGACCACAGTGGATCCACAGCCGCCTCTGTCATGATCTCTCCACGAAACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link