Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
pax3a
- Ensembl ID:
- ENSDARG00000010192
- ZFIN ID:
- ZDB-GENE-980526-52
- Description:
- paired box protein Pax-3 [Source:RefSeq peptide;Acc:NP_571352]
- Human Orthologue:
- PAX3
- Human Description:
- paired box 3 [Source:HGNC Symbol;Acc:8617]
- Mouse Orthologue:
- Pax3
- Mouse Description:
- paired box gene 3 Gene [Source:MGI Symbol;Acc:MGI:97487]
Alleles
There are 2 alleles of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa33020 | Essential Splice Site | Available for shipment | Available now |
| sa39931 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa33020
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000014350 | Essential Splice Site | 29 | 445 | 2 | 9 |
| ENSDART00000038828 | Essential Splice Site | 29 | 509 | 2 | 8 |
- Genomic Location (Zv9):
- Chromosome 2 (position 47582162)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 2 47577636 GRCz11 2 47430140 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CGTTTAGCTTGCATACAATGTCATTCGCTGACTTTTCCTCTTTTGTTGCA[G/A]TCTCTACGCCTTTAGGTCAGGGCCGCGTGAACCAGCTCGGCGGAGTCTTC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa39931
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000014350 | None | 445 | None | 9 | |
| ENSDART00000038828 | Nonsense | 498 | 509 | 8 | 8 |
- Genomic Location (Zv9):
- Chromosome 2 (position 47632094)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 2 47527704 GRCz11 2 47380208 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AAGGTGAATACCAGCACTGTTACTACTGTAGAAAGACTGTCACGTGTTTA[T/A]CCTCTAAAAAGGGCTTCATTTGGATTGGTGGAATAAAGCAAAATATTACT
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Facial morphology: Genome-wide association study of three-dimensional facial morphology identifies a variant in PAX3 associated with nasion position. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
OMIM
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
