zgc:162468

Ensembl ID:
ENSDARG00000010154
ZFIN ID:
ZDB-GENE-060810-69
Description:
hypothetical protein LOC553443 [Source:RefSeq peptide;Acc:NP_001077288]
Human Orthologue:
C10orf72
Human Description:
chromosome 10 open reading frame 72 [Source:HGNC Symbol;Acc:26470]
Mouse Orthologue:
E130203B14Rik
Mouse Description:
RIKEN cDNA E130203B14 gene Gene [Source:MGI Symbol;Acc:MGI:2444633]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa406 Nonsense Available for shipment Available now
sa38951 Essential Splice Site Mutation detected in F1 DNA During 2018
sa12738 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa406
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057469 Nonsense 135 329 2 8

The following transcripts of ENSDARG00000010154 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 31177601)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 30823549
GRCz11 13 30953999
KASP Assay ID:
554-0265.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGGGGGAAACTACACCTGTAAAGTGCAGGAAATACGGAAACACAGAAAC[A/T]AATGGAGGGCCTCGTCCAATGGAACAGGGAGCATGGAATTACGAGGTAAA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa38951
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057469 Essential Splice Site 204 329 5 8

The following transcripts of ENSDARG00000010154 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 31187418)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 30833366
GRCz11 13 30963816
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTACACATTTATTTATACTTTTATGTTTGTTTAACTTTGTCTCCATCTA[G/A]CCAGCTATAACCTGGTGAAGTGTCCAGAAAACAGGTAAACTTATGTAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12738
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057469 Essential Splice Site 215 329 6 8

The following transcripts of ENSDARG00000010154 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 31187543)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 30833491
GRCz11 13 30963941
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTATGTTTKCCTGATTCCAAGGCTCACATTGTTATGTTTTATATCTCCA[G/A]CTCAGGAGAGACAGTAACCRGTRTGTCCAGCTGCTCTCCTGCAATGCACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link