sp5l

Ensembl ID:
ENSDARG00000010124
ZFIN ID:
ZDB-GENE-030131-2981
Description:
Sp5 transcription factor-like [Source:RefSeq peptide;Acc:NP_919352]
Human Orthologue:
SP5
Human Description:
Sp5 transcription factor [Source:HGNC Symbol;Acc:14529]
Mouse Orthologue:
Sp5
Mouse Description:
trans-acting transcription factor 5 Gene [Source:MGI Symbol;Acc:MGI:1927715]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11869 Nonsense Available for shipment Available now
sa43999 Nonsense Mutation detected in F1 DNA During 2018
sa3223 Nonsense F2 line generated During 2018

Mutation Details

Allele Name:
sa11869
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024283 Nonsense 53 357 2 2
Genomic Location (Zv9):
Chromosome 23 (position 28268984)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 28098037
GRCz11 23 28024578
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGYCACCACATGCAGTCAGGCTTGGCAGGAAGGCTCGCAGCTCCCTTAC[G/T]AGGGTCCGGTGGGCTCCGCATCCAGCATGTTCCAGCTCTGGAGCAACGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43999
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024283 Nonsense 87 357 2 2
Genomic Location (Zv9):
Chromosome 23 (position 28268882)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 28097935
GRCz11 23 28024476
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGCCCCGAACTCCAGCTTAAGCGCTCACCAGATGACCTTCACCGTGCCC[A/T]AAATGCAGTTTCCCAGCCACATGCAACCCACTCTGGGCTCGCACTCCCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3223
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024283 Nonsense 211 357 2 2
Genomic Location (Zv9):
Chromosome 23 (position 28268510)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 28097563
GRCz11 23 28024104
KASP Assay ID:
554-2931.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGGACGGCAGCTGGTTTTGGGCCATCAGCCTCAAATTGCAGCRCTTCTG[C/T]AGGGAACCTCCAAAGGTCTGTTGAGCTCKACTCGTCGCTGTCGCCGATGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link