zgc:110270

Ensembl ID:
ENSDARG00000010073
ZFIN ID:
ZDB-GENE-050522-323
Description:
rab-3A-interacting protein [Source:RefSeq peptide;Acc:NP_001018417]
Human Orthologue:
RAB3IP
Human Description:
RAB3A interacting protein (rabin3) [Source:HGNC Symbol;Acc:16508]
Mouse Orthologue:
Rab3ip
Mouse Description:
RAB3A interacting protein Gene [Source:MGI Symbol;Acc:MGI:105933]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa30389 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa30389
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059404 Essential Splice Site 267 430 5 10
Genomic Location (Zv9):
Chromosome Zv9_scaffold3562 (position 38820)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 71111714
GRCz11 4 72769195
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCAGCAGGAGGTGGCGGTGACGCAGCCCATTGTACGTGAGTGCAAAGAG[G/A]TTTGTATCTGCTTGTGTATGTTCAACATCCAGAGTCATGTCCAACATACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link