zgc:158649

Ensembl ID:
ENSDARG00000010035
ZFIN ID:
ZDB-GENE-070112-1332
Description:
Cytosolic endo-beta-N-acetylglucosaminidase [Source:UniProtKB/Swiss-Prot;Acc:A1L251]
Human Orthologue:
ENGASE
Human Description:
endo-beta-N-acetylglucosaminidase [Source:HGNC Symbol;Acc:24622]
Mouse Orthologue:
Engase
Mouse Description:
endo-beta-N-acetylglucosaminidase Gene [Source:MGI Symbol;Acc:MGI:2443788]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1283 Essential Splice Site F2 line generated During 2018

Mutation Details

Allele Name:
sa1283
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002568 Essential Splice Site 229 724 5 14
Genomic Location (Zv9):
Chromosome 3 (position 36147704)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 36018988
GRCz11 3 36148586
KASP Assay ID:
554-1198.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGCWATGGCTTTGACGGCTGGCTAATAAACATAGAAAATGAGCTGAGTG[T/A]GAGTACATAAAGCAATTCTGATGGCATGTATTTGGTATTATGTGTCAAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link