zgc:65890

Ensembl ID:
ENSDARG00000010018
ZFIN IDs:
ZDB-GENE-040426-1462, ZDB-GENE-040426-1462
Description:
Protein quaking-B [Source:UniProtKB/Swiss-Prot;Acc:Q6P104]
Human Orthologue:
QKI
Human Description:
quaking homolog, KH domain RNA binding (mouse) [Source:HGNC Symbol;Acc:21100]
Mouse Orthologue:
Qk
Mouse Description:
quaking Gene [Source:MGI Symbol;Acc:MGI:97837]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22153 Nonsense Available for shipment Available now
sa9454 Nonsense Available for shipment Available now
sa6268 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa22153
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027034 Nonsense 25 319 1 7
ENSDART00000123988 Nonsense 4 297 2 8
Genomic Location (Zv9):
Chromosome 12 (position 36369701)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 34852724
GRCz11 12 34953787
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGAGAAGCCTAAGCCCACTCCTGATTATCTGATGCAGCTCATGAACGAC[A/T]AGAAGCTGATGAGCAGCCTGCCAAACTTCTGTGGGATCTTCAACCATCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9454
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027034 Nonsense 51 319 2 7
ENSDART00000123988 Nonsense 30 297 3 8
Genomic Location (Zv9):
Chromosome 12 (position 36342319)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 34880106
GRCz11 12 34981169
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTGCCTTTATATAATGGAGTTTTACTGTGTCTGTTTGGTAGAAATTGGA[C/T]GAGTACGGAAGGACATGTACAATGACACTCTGAACGGCAGCACAGACAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6268
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027034 Essential Splice Site 182 319 4 7
ENSDART00000123988 Essential Splice Site 161 297 5 8
Genomic Location (Zv9):
Chromosome 12 (position 36321304)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 34901121
GRCz11 12 35002184
KASP Assay ID:
554-5370.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAAACTCAAGAGGGCCGTCGAGGAGGTCAAGAAACTGCWAGTCCCTGCC[G/A]TGAGTCATTTATCTCTCTGTTCTCGTGACCTTATGTGTATTTATTGAGAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link