
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
mag
- Ensembl ID:
- ENSDARG00000009965
- ZFIN ID:
- ZDB-GENE-041217-24
- Description:
- myelin-associated glycoprotein [Source:RefSeq peptide;Acc:NP_001007063]
- Human Orthologue:
- MAG
- Human Description:
- myelin associated glycoprotein [Source:HGNC Symbol;Acc:6783]
- Mouse Orthologue:
- Mag
- Mouse Description:
- myelin-associated glycoprotein Gene [Source:MGI Symbol;Acc:MGI:96912]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa15231 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa15231
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > G
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000016753 | Nonsense | 116 | 653 | 2 | 10 |
ENSDART00000077424 | Nonsense | 116 | 635 | 2 | 9 |
- Genomic Location (Zv9):
- Chromosome 15 (position 31972255)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 15 34044292 GRCz11 15 33902271 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AACTGCACACTGCTGATAAGTAACATTGGCGTGGAACATTCTGGAAAGTA[T/G]TACTTCAGGGCAGATCTTGGTGGAGCGAATATCTACACTTTTCCTGACTT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: