Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
erc1a
- Ensembl ID:
- ENSDARG00000009941
- ZFIN IDs:
- ZDB-GENE-091214-5, ZDB-GENE-091214-5
- Description:
- ELKS [Source:RefSeq peptide;Acc:NP_001015065]
- Human Orthologue:
- ERC1
- Human Description:
- ELKS/RAB6-interacting/CAST family member 1 [Source:HGNC Symbol;Acc:17072]
- Mouse Orthologue:
- Erc1
- Mouse Description:
- ELKS/RAB6-interacting/CAST family member 1 Gene [Source:MGI Symbol;Acc:MGI:2151013]
Alleles
There are 3 alleles of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa44299 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
| sa24672 | Essential Splice Site | Available for shipment | Available now |
| sa24673 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa44299
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000012923 | Essential Splice Site | 229 | 970 | 1 | 17 |
| ENSDART00000041169 | Essential Splice Site | 229 | 966 | 1 | 16 |
- Genomic Location (Zv9):
- Chromosome 25 (position 21851934)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 25 21083810 GRCz11 25 21181464 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AATATCAGTGTGGAAGGAGCAGTACCGCGCTGTGCAAGATGAGACACAGG[T/C]GGGTACATCTGGCAGGGTATGCTTGTTTTTTAAGCATAAGTGGACGTTTA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa24672
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000012923 | Essential Splice Site | 355 | 970 | 2 | 17 |
| ENSDART00000041169 | Essential Splice Site | 355 | 966 | 2 | 16 |
- Genomic Location (Zv9):
- Chromosome 25 (position 21865203)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 25 21097079 GRCz11 25 21194733 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGGAGAACCTGCTAGAACAGCGGGATAAAGAGCTGGTGGCTCTCAGAGAG[G/A]TGTGTGACAACTGGAGATGAAACATACATTACAAAATATTACATTTATAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa24673
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000012923 | Nonsense | 780 | 970 | 12 | 17 |
| ENSDART00000041169 | Nonsense | 776 | 966 | 11 | 16 |
- Genomic Location (Zv9):
- Chromosome 25 (position 21892356)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 25 21124232 GRCz11 25 21221886 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GCAAACACAAGGAGCCGCCGGGAAAGGGCAGAAATGTCAACGATGGCCCA[C/T]AGCAGGTGAGGTGAACAGAGAGATGGTTATGACAGTTCTGTCTCTTTTGA
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Bone mineral density: Genome-wide meta-analysis identifies 56 bone mineral density loci and reveals 14 loci associated with risk of fracture. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
