si:dkey-48j7.5

Ensembl ID:
ENSDARG00000009901
ZFIN ID:
ZDB-GENE-081105-92
Description:
Novel protein similar to H.sapiens SLC38A3, solute carrier family 38, member 3 (SLC38A3) [Source:Uni
Human Orthologue:
SLC38A5
Human Description:
solute carrier family 38, member 5 [Source:HGNC Symbol;Acc:18070]
Mouse Orthologue:
Slc38a5
Mouse Description:
solute carrier family 38, member 5 Gene [Source:MGI Symbol;Acc:MGI:2148066]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41216 Essential Splice Site Mutation detected in F1 DNA During 2018
sa41217 Essential Splice Site Mutation detected in F1 DNA During 2018
sa16895 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa41216
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062385 Essential Splice Site 91 491 4 15
ENSDART00000133983 Essential Splice Site 40 440 2 13
Genomic Location (Zv9):
Chromosome 8 (position 26472328)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 25600246
GRCz11 8 25619385
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTATTGTTTTGTTGCCAATACCCAAGTTAATCATTTGTGTCTTTTTCTTC[A/G]GATTTCTGTTGATAACCATCGCTTTGCTCTCTTCTTACTCTATCCATCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41217
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062385 Essential Splice Site 174 491 6 15
ENSDART00000133983 Essential Splice Site 123 440 4 13
Genomic Location (Zv9):
Chromosome 8 (position 26472797)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 25600715
GRCz11 8 25619854
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGTTACCTCATGTCATTGAAGGTCTCACAGGACTGCCAGACAACTCTGG[G/A]TGAGTACTGAAAAATACTTCTGATGGGTTCAGCTGTTTGAGACCATGTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16895
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062385 Essential Splice Site 424 491 14 15
ENSDART00000133983 Essential Splice Site 373 440 12 13
Genomic Location (Zv9):
Chromosome 8 (position 26476137)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 25604055
GRCz11 8 25623194
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTCTATCATTCGAATGCAGCACTTTGTGATACATTTTATACTATATTTC[A/T]GGTGCARCATCTGCTCCCAGCCTCATTTTCATTCTGCCAGGAATATTCTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link