si:dkey-266f7.7

Ensembl ID:
ENSDARG00000009890
ZFIN IDs:
ZDB-GENE-070705-438, ZDB-GENE-080207-3
Description:
Novel protein similar to envelope protein (Env) [Source:UniProtKB/TrEMBL;Acc:A5WV53]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10301 Nonsense Available for shipment Available now
sa11036 Nonsense Available for shipment Available now
sa10881 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10301
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009012 Nonsense 10 642 1 1
ENSDART00000009012 Nonsense 10 642 1 1
ENSDART00000009012 Nonsense 10 642 1 1
Genomic Location (Zv9):
Chromosome 19 (position 8588680)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 8047219
GRCz11 19 7966144
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCAGGTAATTCTCCTAACAAAATGAATATAAACAAGATGGTGGTGGCCT[G/A]GGGAGTAATGTTGGTGRTRATCCTATGGRTAATCTGCYATATGGAATTCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11036
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009012 Nonsense 10 642 1 1
ENSDART00000009012 Nonsense 10 642 1 1
ENSDART00000009012 Nonsense 10 642 1 1
Genomic Location (Zv9):
Chromosome 19 (position 8588680)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 8047219
GRCz11 19 7966144
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCAGGTAATTCTCCTAACAAAATGAATATAAACAAGATGGTGGTGGCCT[G/A]GGGAGTAATGTTGGTGRTRATCCTATGGRTAATCTGCYATATGGAATTCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10881
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009012 Nonsense 10 642 1 1
ENSDART00000009012 Nonsense 10 642 1 1
ENSDART00000009012 Nonsense 10 642 1 1
Genomic Location (Zv9):
Chromosome 19 (position 8588680)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 8047219
GRCz11 19 7966144
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCAGGTAATTCTCCTAACAAAATGAATATAAACAAGATGGTGGTGGCCT[G/A]GGGAGTAATGTTGGTGRTRATCCTATGGRTAATCTGCYATATGGAATTCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link