
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
ier5
- Ensembl ID:
- ENSDARG00000009881
- ZFIN ID:
- ZDB-GENE-030616-127
- Description:
- immediate early response gene 5 protein [Source:RefSeq peptide;Acc:NP_001007198]
- Human Orthologue:
- IER5
- Human Description:
- immediate early response 5 [Source:HGNC Symbol;Acc:5393]
- Mouse Orthologue:
- Ier5
- Mouse Description:
- immediate early response 5 Gene [Source:MGI Symbol;Acc:MGI:1337072]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa1887 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa1887
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000014330 | Nonsense | 122 | 270 | 1 | 1 |
- Genomic Location (Zv9):
- Chromosome 22 (position 16720201)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 22 16471959 GRCz11 22 16498229 - KASP Assay ID:
- 554-1877.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GAGCGGGAATATCGCGAAAACGACGCTGAGAAATCAGAACGAGTGGATTG[T/A]ACYTCCACTTCTGAGCAAGAAAGCAACCAAAACTCTTCTTTAGACTCGGT
- Associated Phenotype:
Normal
Stage Entity Quality Tag Larval:Day 5
ZFS:0000037whole organism
ZFA:0001094quality
PATO:0000001normal
PATO:0000461
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: