
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:ch73-379f5.3
- Ensembl ID:
- ENSDARG00000009874
- ZFIN ID:
- ZDB-GENE-091113-2
- Human Orthologue:
- CYP2W1
- Human Description:
- cytochrome P450, family 2, subfamily W, polypeptide 1 [Source:HGNC Symbol;Acc:20243]
- Mouse Orthologue:
- Cyp2w1
- Mouse Description:
- cytochrome P450, family 2, subfamily w, polypeptide 1 Gene [Source:MGI Symbol;Acc:MGI:3616076]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa39999 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa19949 | Essential Splice Site | Available for shipment | Available now |
sa31312 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa39999
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000059185 | Nonsense | 40 | 503 | 1 | 9 |
ENSDART00000143522 | Nonsense | 47 | 510 | 1 | 9 |
- Genomic Location (Zv9):
- Chromosome 3 (position 8857254)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 3 8394721 GRCz11 3 8272463 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CTGTTTTTATTTATTTCTTTCTTCTCCAGCTCTCAGGATGAGGGAAAATA[T/A]CCTCCAGGACCCAAACCTCTGCCACTGCTGGGGAACCTGCACATTCTGGA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa19949
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000059185 | Essential Splice Site | 122 | 503 | 2 | 9 |
ENSDART00000143522 | Essential Splice Site | 129 | 510 | 2 | 9 |
- Genomic Location (Zv9):
- Chromosome 3 (position 8855205)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 3 8392672 GRCz11 3 8270414 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GGAGACAGAGATATTTCACCCATATTCCACGATTTCAACCAGGGTTATGG[T/A]AAGAGGACTTTCCTATATTTAGATGACTGGTAAATAAACATTTTATGTGT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa31312
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000059185 | Nonsense | 253 | 503 | 5 | 9 |
ENSDART00000143522 | Nonsense | 260 | 510 | 5 | 9 |
- Genomic Location (Zv9):
- Chromosome 3 (position 8850184)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 3 8387651 GRCz11 3 8265393 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTGTGGCTAATCAGAAGCGCATTATAAACAACGTCAAAGAAGCCTTTAAA[C/T]AAAGTGGGGAAATAATGAATGGTCTGAAGAACACTCTGAACCCTCAAGAC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: