
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
cyp19a1b
- Ensembl ID:
- ENSDARG00000009852
- ZFIN ID:
- ZDB-GENE-001103-4
- Description:
- cytochrome P450, family 19, subfamily A, polypeptide 1b [Source:RefSeq peptide;Acc:NP_571717]
- Human Orthologue:
- CYP19A1
- Human Description:
- cytochrome P450, family 19, subfamily A, polypeptide 1 [Source:HGNC Symbol;Acc:2594]
- Mouse Orthologue:
- Cyp19a1
- Mouse Description:
- cytochrome P450, family 19, subfamily a, polypeptide 1 Gene [Source:MGI Symbol;Acc:MGI:88587]
Alleles
There are 4 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa24593 | Essential Splice Site | Available for shipment | Available now |
sa5094 | Nonsense | F2 line generated | During 2018 |
sa37992 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa37991 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa24593
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000025590 | Essential Splice Site | 150 | 511 | 3 | 9 |
ENSDART00000055885 | Essential Splice Site | 149 | 400 | 3 | 10 |
ENSDART00000130307 | Essential Splice Site | 150 | 511 | 4 | 10 |
- Genomic Location (Zv9):
- Chromosome 25 (position 4911544)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 25 4772786 GRCz11 25 4899214 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CAACAGCAACATCGCAAAGTGGAAGAAAGTGAGAACATACTTCACTAAAG[G/C]TGAGTGTTAATCTCTGGTCTCACATCATTTCACACAGAGAATCATCAGAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa5094
- Current Status:
-
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000025590 | Nonsense | 381 | 511 | 8 | 9 |
ENSDART00000055885 | Nonsense | 349 | 400 | 9 | 10 |
ENSDART00000130307 | Nonsense | 381 | 511 | 9 | 10 |
- Genomic Location (Zv9):
- Chromosome 25 (position 4908506)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 25 4769748 GRCz11 25 4896176 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TACCATCCGGTGGTGGATTTCATCATGAGGCAGTCTCTGGAGGAYGACTA[C/A]ATTGATGGCTACCGGGTGGCAAAGGGGACAAACCTAATCCTGAACATTGG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa37992
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000025590 | Nonsense | 407 | 511 | 8 | 9 |
ENSDART00000055885 | Nonsense | 375 | 400 | 9 | 10 |
ENSDART00000130307 | Nonsense | 407 | 511 | 9 | 10 |
- Genomic Location (Zv9):
- Chromosome 25 (position 4908430)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 25 4769672 GRCz11 25 4896100 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GGACAAACCTAATCCTGAACATTGGACGCATGCATAAGACAGAGTTCTTC[A/T]AAAAACCCAACGAATTCAGCTTGGAGAACTTCGAGAACACTGTAAGTCAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa37991
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000025590 | Nonsense | 427 | 511 | 9 | 9 |
ENSDART00000055885 | None | 400 | None | 10 | |
ENSDART00000130307 | Nonsense | 427 | 511 | 10 | 10 |
- Genomic Location (Zv9):
- Chromosome 25 (position 4905898)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 25 4767140 GRCz11 25 4893568 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGCTAGTCTTATCAACTCTGCCTCCTTCTCAGGTTCCCAGTCGTTACTTC[C/T]AGCCATTCGGTTGTGGTCCGCGGGCCTGTGTTGGGAAGCACATTGCTATG
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Height: A genome-wide association study in 19 633 Japanese subjects identified LHX3-QSOX2 and IGF1 as adult height loci. (View Study)
- Height: Genome-wide association study in Han Chinese identifies three novel loci for human height. (View Study)
- Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)
- T-tau: Genome-wide association reveals genetic effects on human Aβ42 and τ protein levels in cerebrospinal fluids: a case control study. (View Study)
- Testosterone levels: Genome-wide association study of circulating estradiol, testosterone, and sex hormone-binding globulin in postmenopausal women. (View Study)
- Thiazide-induced adverse metabolic effects in hypertensive patients: Genome-wide association analyses suggest NELL1 influences adverse metabolic response to HCTZ in African Americans. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: