wdr41

Ensembl ID:
ENSDARG00000009851
ZFIN ID:
ZDB-GENE-050706-152
Description:
WD repeat-containing protein 41 [Source:RefSeq peptide;Acc:NP_001025432]
Human Orthologue:
WDR41
Human Description:
WD repeat domain 41 [Source:HGNC Symbol;Acc:25601]
Mouse Orthologue:
Wdr41
Mouse Description:
WD repeat domain 41 Gene [Source:MGI Symbol;Acc:MGI:2445123]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa45727 Essential Splice Site Mutation detected in F1 DNA During 2018
sa17407 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa45727
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021272 Essential Splice Site 55 282 2 14
ENSDART00000121813 Essential Splice Site 55 449 2 13
Genomic Location (Zv9):
Chromosome 21 (position 7549211)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 7871678
GRCz11 21 7609346
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGGACACTTTGACATTGTTCGATTTCTGGTGCAGATTGATGACTTAAGG[T/C]AAGCAATCCTCTTCTCCTCTGACCAGTGATTGACAGCTCCGACCGAGCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17407
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021272 Nonsense 77 282 4 14
ENSDART00000121813 Nonsense 77 449 4 13
Genomic Location (Zv9):
Chromosome 21 (position 7554173)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 7876640
GRCz11 21 7614308
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCCNTTTTTTAGCCTTKTATTTTGTGTGTTTCAGACTGGTGATTGTTTGT[T/A]GGAGTTGCGCGGCCACACACAGCAGATCACAGCRATGACATCATACACCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Caudate nucleus volume: Discovery and replication of dopamine-related gene effects on caudate volume in young and elderly populations (N=1198) using genome-wide search. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link