smfn

Ensembl ID:
ENSDARG00000009806
ZFIN ID:
ZDB-GENE-040426-1709
Description:
oligoribonuclease, mitochondrial [Source:RefSeq peptide;Acc:NP_957038]
Human Orthologue:
REXO2
Human Description:
REX2, RNA exonuclease 2 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:17851]
Mouse Orthologue:
Rexo2
Mouse Description:
REX2, RNA exonuclease 2 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1888981]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34971 Nonsense Available for shipment Available now
sa41720 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa34971
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003435 Nonsense 180 259 5 7
Genomic Location (Zv9):
Chromosome 10 (position 41265334)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 39979960
GRCz11 10 39901447
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCATCCACAGGGAACTCTGTTCACGCCGACAAGAAGTTTCTGGATAAATA[C/A]ATGCCTCAGTTCATGCACCACCTGCACTATCGCATCATAGATGTGAGCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41720
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003435 Nonsense 232 259 7 7
Genomic Location (Zv9):
Chromosome 10 (position 41268689)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 39983315
GRCz11 10 39904802
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTCTGTTTGAATTTTTAGAGCGCTGGACGACATCCAGGAGAGCATTAAA[G/T]AACTGCAGTTTTACAGAACGAGTGTTTTCAAAGCCAAGGAGAAGAAAAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link