zgc:66299

Ensembl ID:
ENSDARG00000009796
ZFIN ID:
ZDB-GENE-040426-1599
Description:
kinesin light chain 1 [Source:RefSeq peptide;Acc:NP_957247]
Human Orthologue:
C14orf153
Human Description:
chromosome 14 open reading frame 153 [Source:HGNC Symbol;Acc:20492]
Mouse Orthologue:
Klc1
Mouse Description:
kinesin light chain 1 Gene [Source:MGI Symbol;Acc:MGI:107978]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa38928 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa38928
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008987 Nonsense 367 538 10 15
ENSDART00000010560 Nonsense 537 684 12 17
ENSDART00000137061 Nonsense 420 600 10 15
Genomic Location (Zv9):
Chromosome 13 (position 15828399)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 15743432
GRCz11 13 15874424
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCAGGCAGAGACTCTATATAAAGAGATCCTCACCCGAGCCCATGAGAGA[G/T]AATTTGGTTCTGTTGATGGTATGTATGCCTTTTTCATAACTCTTACATCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link