
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
dirc2
- Ensembl ID:
- ENSDARG00000009783
- ZFIN ID:
- ZDB-GENE-040912-167
- Description:
- disrupted in renal carcinoma 2 [Source:RefSeq peptide;Acc:NP_001004597]
- Human Orthologue:
- DIRC2
- Human Description:
- disrupted in renal carcinoma 2 [Source:HGNC Symbol;Acc:16628]
- Mouse Orthologue:
- Dirc2
- Mouse Description:
- disrupted in renal carcinoma 2 (human) Gene [Source:MGI Symbol;Acc:MGI:2387188]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa34701 | Nonsense | Available for shipment | Available now |
sa13846 | Essential Splice Site | Available for shipment | Available now |
sa21541 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa34701
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000016370 | Nonsense | 207 | 466 | 3 | 9 |
- Genomic Location (Zv9):
- Chromosome 9 (position 38439698)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 9 37577594 GRCz11 9 37387389 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GCCGTCCCTGCACCCAATGACACTGAGAAATTGGGAAACGTCATCTACTG[G/A]AACCAAAACCACATAGGAAACAGGATACAGTTTGTTCTTTACACAGGTAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa13846
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000016370 | Essential Splice Site | 266 | 466 | 5 | 9 |
- Genomic Location (Zv9):
- Chromosome 9 (position 38454755)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 9 37592651 GRCz11 9 37402446 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TCTGGTGCTAAAATGTCTCATCAGTTTTCATCTTTGCTTTTGCTTTTKCA[G/A]CAACATGCGTTTCCTGATGATAGCACTCGCCTACTCCGTGCCCACAGGGG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa21541
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000016370 | Nonsense | 433 | 466 | 9 | 9 |
- Genomic Location (Zv9):
- Chromosome 9 (position 38503800)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 9 37641696 GRCz11 9 37451491 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCACTAACCCCGATCACCCTTGCTATTTTGTTTTTCAGAGCTGTCCTGGT[T/A]GAACTGGTGTCTGACAGGATCCTGCATCTTCAGTCTCCTGCTCCTCCTCC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: