myh11a
- Ensembl ID:
- ENSDARG00000009782
- ZFIN ID:
- ZDB-GENE-050531-1
- Description:
- myosin-11 [Source:RefSeq peptide;Acc:NP_001019619]
- Human Orthologue:
- MYH11
- Human Description:
- myosin, heavy chain 11, smooth muscle [Source:HGNC Symbol;Acc:7569]
- Mouse Orthologue:
- Myh11
- Mouse Description:
- myosin, heavy polypeptide 11, smooth muscle Gene [Source:MGI Symbol;Acc:MGI:102643]
Alleles
There are 9 alleles of this gene:
Allele name |
Consequence |
Status |
Availability Estimate |
sa20640 |
Nonsense |
Available for shipment |
Available now |
sa11268 |
Nonsense |
Available for shipment |
Available now |
sa15692 |
Essential Splice Site |
Available for shipment |
Available now |
sa7029 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa20641 |
Nonsense |
Available for shipment |
Available now |
sa16962 |
Nonsense |
Available for shipment |
Available now |
sa40634 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa16661 |
Essential Splice Site |
Available for shipment |
Available now |
sa20642 |
Nonsense |
Available for shipment |
Available now |
Mutation Details
- Allele Name:
- sa20640
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
- Mutation:
- G > A
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 6 (position 9227144)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
6 |
8333520 |
GRCz11 |
6 |
8569059 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CTTTTCACGGACAAAGACTTCATCAACAGCCCCGTGGCCCAGGCCGATTG[G/A]TCAGCCAAAAAGCTGGTGTGGGTCCCCTCCGAAAAGCACGGCTTCGAGTC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa11268
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- C > A
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 6 (position 9260748)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
6 |
8299916 |
GRCz11 |
6 |
8535455 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- CTMCCATTACAGGCTGATTTTGCCATTGAAGCTTTAGCTAAAGCTATGTA[C/A]GAACGCTTGTTYCGTTGGATCCTTCTAAGAGTCAACAAAGCGTTAGACAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa15692
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
- Genomic Location (Zv9):
- Chromosome 6 (position 9263120)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
6 |
8297544 |
GRCz11 |
6 |
8533083 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- ACACACAGCCAAACTTTGTCCGCTGTATTATCCCCAACCATGAGAAACGG[G/A]TATATTGCCATCRTATTAGAWACCAAAAGTGGTGGTACAAANTCTTTTTGG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa7029
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 6 (position 9264573)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
6 |
8296091 |
GRCz11 |
6 |
8531630 |
- KASP Assay ID:
- 554-4668.1 (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- AAAATAGTAAGGTTAAAAACNAKTTTGCATTTACATATTGACATACAGATA[T/A]GAGATCCTGGCAGCGAATGCTATTCCAAAAGGCTTCATGGATGGCAAGCA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa20641
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 6 (position 9272369)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
6 |
8288295 |
GRCz11 |
6 |
8523834 |
- KASP Assay ID:
- 2259-7167.1 (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CTATAGAGGACGAGAGCCGCGTCCATGAGGCTCAGGTGCAGGAGATGAGA[C/T]AGAAACACACCCAAGCTTTGGAGGAGCTCACAGAGCAACTGGAGCAGTCC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa16962
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- C > T
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 6 (position 9274360)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
6 |
8286304 |
GRCz11 |
6 |
8521843 |
- KASP Assay ID:
- 2259-7168.1 (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- GAAAGAACATAAAGCTTAGYAAGGATGTGGCTAGCTTGAGTTCTCAAGTT[C/T]AAGACACWCAGGTATGAGGGTCAAAAACGAGACATCTTATTTTGGTGTCW
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa40634
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 6 (position 9276121)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
6 |
8284543 |
GRCz11 |
6 |
8520082 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GAAGACCAAGAACAGACTGCAGCAGGAGCTTGAGGACACGCTGATGGATT[T/A]GGACAACCAGAGACAGCTGGTGTCCAACCTTGAGAAGAAACAGAAGAAGT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa16661
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- T > G
- Consequence:
- Essential Splice Site
- Genomic Location (Zv9):
- Chromosome 6 (position 9277233)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
6 |
8283431 |
GRCz11 |
6 |
8518970 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- TGCTGAAATGGAGGATCTAGTCAGCTCCAAAGACGAYGTRGGCAAAAACG[T/G]AAGTTCAGYAGTGTAARGGAAAATTTGAAACATTCCTTGCATTGGAATAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa20642
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 6 (position 9282272)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
6 |
8278392 |
GRCz11 |
6 |
8513931 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGGAGCAAGGCAACATGGAGATGCTCAATGACAGGCTGAGAAAGAGCGCA[C/T]AGCAGGTACATGCGTTACAGTACATCAAATAGACATTAATATTAGGGATG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes
(for example, a new allele is generated or an allele is made available
for distribution) then please enter your details below: