zgc:100974

Ensembl ID:
ENSDARG00000009764
ZFIN ID:
ZDB-GENE-040801-132
Description:
splicing factor, arginine/serine-rich 12 [Source:RefSeq peptide;Acc:NP_001003613]
Human Orthologue:
SREK1
Human Description:
splicing regulatory glutamine/lysine-rich protein 1 [Source:HGNC Symbol;Acc:17882]
Mouse Orthologue:
Srek1
Mouse Description:
splicing regulatory glutamine/lysine-rich protein 1 Gene [Source:MGI Symbol;Acc:MGI:2145245]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40563 Essential Splice Site Mutation detected in F1 DNA During 2018
sa6064 Essential Splice Site Mutation detected in F1 DNA During 2018
sa20535 Nonsense Available for shipment Available now
sa13077 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa40563
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016995 Essential Splice Site 238 512 6 13
ENSDART00000121459 Essential Splice Site 238 512 6 13
ENSDART00000134937 Essential Splice Site 241 515 6 12
Genomic Location (Zv9):
Chromosome 5 (position 55764083)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 54548753
GRCz11 5 55171589
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTGCATCCTATTTTTATAAGTGATTGATCAGCCTGACTTCATCTTATTC[A/T]GGATTAACCACTCCAATAATGCCATAGTGAAGCCTCCAGAGCTTACACCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6064
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016995 Essential Splice Site 317 512 7 13
ENSDART00000121459 Essential Splice Site 317 512 7 13
ENSDART00000134937 Essential Splice Site 320 515 7 12
Genomic Location (Zv9):
Chromosome 5 (position 55763754)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 54548424
GRCz11 5 55171260
KASP Assay ID:
554-3796.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTGTTCTCCATCTAACTCAAGAAGAAAGCGATCCAGGTCTAGACACAGG[T/C]GATTTACACGCAACCTTAGTAGTTTGTGAAGCYAATAGCTACTCACTATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20535
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016995 Nonsense 387 512 9 13
ENSDART00000121459 Nonsense 387 512 9 13
ENSDART00000134937 Nonsense 390 515 9 12
Genomic Location (Zv9):
Chromosome 5 (position 55760641)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 54545311
GRCz11 5 55168147
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATGAAAAGAGGCTGCGGGACAAAACAGGAAGATCGCCTCCAAAATGCTA[T/A]GTTGGTTCCAGACGGTCCCGCAGTACAAGCAGGTTAGAAGAAAATGTCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13077
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016995 Nonsense 391 512 9 13
ENSDART00000121459 Nonsense 391 512 9 13
ENSDART00000134937 Nonsense 394 515 9 12
Genomic Location (Zv9):
Chromosome 5 (position 55760631)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 54545301
GRCz11 5 55168137
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCTGCGGGAMAAAACAGGAAGATCGCCTCCAAAATGCTATGTTGGTTCC[A/T]GACKRTCCCGCAGTACAAGCAGGTTAGAAGAAAATGTCCTTTTTTGCTAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link