zgc:73328

Ensembl ID:
ENSDARG00000009754
ZFIN IDs:
ZDB-GENE-030131-3272, ZDB-GENE-030131-3272, ZDB-GENE-030131-3272
Description:
zinc finger CCCH type containing 11A-like [Source:RefSeq peptide;Acc:NP_955980]
Human Orthologue:
ZC3H11A
Human Description:
zinc finger CCCH-type containing 11A [Source:HGNC Symbol;Acc:29093]
Mouse Orthologue:
Zc3h11a
Mouse Description:
zinc finger CCCH type containing 11A Gene [Source:MGI Symbol;Acc:MGI:1917829]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11501 Essential Splice Site Available for shipment Available now
sa2592 Nonsense F2 line generated During 2018

Mutation Details

Allele Name:
sa11501
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034027   None 794 None 15
ENSDART00000103766 Essential Splice Site None 358 1 13
ENSDART00000128309 Essential Splice Site None 794 1 17
Genomic Location (Zv9):
Chromosome 11 (position 25023082)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 23796640
GRCz11 11 24034497
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCTACGTGCATCAACCCGAACATACTTAATTCCACTCGGTATAAACTGG[T/G]AATTGTGCTAGATTAATTTAAAGTAAATGTTNTTAAACRTTTTATTTAWT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2592
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034027 Nonsense 40 794 2 15
ENSDART00000103766 Nonsense 40 358 4 13
ENSDART00000128309 Nonsense 40 794 4 17
Genomic Location (Zv9):
Chromosome 11 (position 25020448)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 23799274
GRCz11 11 24037131
KASP Assay ID:
554-2701.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTCGACACTGTGAGGCTGCCATGGGTAGTGAAACGGTTTGCAACCTGTG[G/A]CAAGAGCAAAGATGCTTCCGTAACGTCTGCAAGTTTCGACACATGGAAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link