zgc:111944

Ensembl ID:
ENSDARG00000009735
ZFIN ID:
ZDB-GENE-050706-185
Description:
PERQ amino acid-rich with GYF domain-containing protein 2 [Source:UniProtKB/Swiss-Prot;Acc:Q4KME6]
Human Orthologue:
GIGYF2
Human Description:
GRB10 interacting GYF protein 2 [Source:HGNC Symbol;Acc:11960]
Mouse Orthologue:
Gigyf2
Mouse Description:
GRB10 interacting GYF protein 2 Gene [Source:MGI Symbol;Acc:MGI:2138584]

Alleles

There are 14 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19882 Nonsense Available for shipment Available now
sa33026 Essential Splice Site Mutation detected in F1 DNA During 2018
sa33025 Nonsense Mutation detected in F1 DNA During 2018
sa39936 Nonsense Mutation detected in F1 DNA During 2018
sa18439 Essential Splice Site Available for shipment Available now
sa8785 Essential Splice Site Mutation detected in F1 DNA During 2018
sa39935 Nonsense Mutation detected in F1 DNA During 2018
sa11852 Nonsense Available for shipment Available now
sa19881 Nonsense Available for shipment Available now
sa39934 Nonsense Mutation detected in F1 DNA During 2018
sa38357 Nonsense Mutation detected in F1 DNA During 2018
sa18740 Nonsense Mutation detected in F1 DNA During 2018
sa19880 Nonsense Available for shipment Available now
sa10322 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa19882
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056277 Nonsense 38 1329 3 29
ENSDART00000146705 Nonsense 38 1329 2 28
Genomic Location (Zv9):
Chromosome 2 (position 48359422)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 48391086
GRCz11 2 48245250
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCAGCAGCATTGTGGCCTCCCCTCCGCTCTCGCCTGCATTGCCAAAGTA[T/A]AAACTTGCAGACTATCGCTACGGGAGAGAAGAGATGCTAGCACTTTATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33026
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056277 Essential Splice Site 92 1329 5 29
ENSDART00000146705 Essential Splice Site 92 1329 4 28
Genomic Location (Zv9):
Chromosome 2 (position 48357273)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 48388937
GRCz11 2 48243101
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATGATGAAGTGGCACTTGCGTTACTATGCATATGTGTGAATCTCTCCGC[A/T]GAGAAATTTCTCCATGTCTGTAAACAGTGCAGCAGTTCTCCGTCTGACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33025
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056277 Nonsense 125 1329 5 29
ENSDART00000146705 Nonsense 125 1329 4 28
Genomic Location (Zv9):
Chromosome 2 (position 48357172)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 48388836
GRCz11 2 48243000
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAGGGGGGGAGGGACGGTGGCAGGGGCACCTAGAGGCCGAAGTTCTTCA[C/T]GAGGGCGAGGTGAGCTACGTTGCAACCGCACAATTACCTTTTTTCCTTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39936
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056277 Nonsense 289 1329 10 29
ENSDART00000146705 Nonsense 289 1329 9 28
Genomic Location (Zv9):
Chromosome 2 (position 48354349)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 48386013
GRCz11 2 48240177
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCGTAGGCCTCGGTCGGGCAGCGGGAGCGCAGAGGAGGAGAGGGACAGTT[T/A]ACCAGAATGGTGTCTGGAAGATGCAGAGGAGGAGACAGGGACGTTTGACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18439
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056277 Essential Splice Site 319 1329 10 29
ENSDART00000146705 Essential Splice Site 319 1329 9 28
Genomic Location (Zv9):
Chromosome 2 (position 48354256)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 48385920
GRCz11 2 48240084
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTTGACTCCTCAGGGGCCTTCCTCTCACTTAAGGTGAGGGCGCTGGAAG[T/C]GAGTGGTKGAGCTTTGATTAATCATTTTACAWTTTTGAATGYTYGATAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8785
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056277 Essential Splice Site 519 1329 13 29
ENSDART00000146705 Essential Splice Site 519 1329 12 28
Genomic Location (Zv9):
Chromosome 2 (position 48351519)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 48383183
GRCz11 2 48237347
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCTGCCATCGGACTTGGATGAGGATGAGGGACTCAAGCACTTTGAGCAG[G/A]TCTGAACCGCTAWGTACTCGACAGTTAAANNCATGCAGCTGAATAGTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39935
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056277 Nonsense 612 1329 15 29
ENSDART00000146705 Nonsense 612 1329 14 28
Genomic Location (Zv9):
Chromosome 2 (position 48346766)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 48378430
GRCz11 2 48232594
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATGCGACGAGATGTTCCAGCCTCTGGGCGAGATGATTAAGTTGTGGGGA[C/T]GAGTGCCCTTTACACCGGGCCCGACACTACCTCCCATACTGGTAATATAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11852
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056277 Nonsense 636 1329 16 29
ENSDART00000146705 Nonsense 636 1329 15 28
Genomic Location (Zv9):
Chromosome 2 (position 48346592)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 48378256
GRCz11 2 48232420
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGTGTTTGACTCAATATAGGGAGATGCAGATCAAGAAAGGATGRAGAGA[C/T]AACAGGAGATTAATGCTCTAAATATGTATCAGCTACAGCAGATGCAATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19881
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056277 Nonsense 651 1329 16 29
ENSDART00000146705 Nonsense 651 1329 15 28
Genomic Location (Zv9):
Chromosome 2 (position 48346547)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 48378211
GRCz11 2 48232375
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAGACAACAGGAGATTAATGCTCTAAATATGTATCAGCTACAGCAGATG[C/T]AATATCAGTATTTACTCAGGTATGAGAGAAGATTATGAAGCGACATGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39934
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056277 Nonsense 660 1329 17 29
ENSDART00000146705 Nonsense 660 1329 16 28
Genomic Location (Zv9):
Chromosome 2 (position 48345152)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 48376816
GRCz11 2 48230980
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTAATTGTTAACCACTAAACTCACTCTCTTTTCTTTTAGGCAACAATA[T/A]GCTCTGCAGCAGAAAGTGTTAAACTCTGCTCCTCCTCCTCCTCCACCACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38357
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056277 Nonsense 815 1329 20 29
ENSDART00000146705 Nonsense 815 1329 19 28
Genomic Location (Zv9):
Chromosome 2 (position 48339649)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 48371313
GRCz11 2 48225477
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGCGAGACAAGAGGAAGAGAGGAAGCGTTTAGAGGAAGAAGAGCTGGCA[C/T]GACGCAAGCAGGTCAGGAGACAACAAAAAATATGCTGTCGACATCAGGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18740
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056277 Nonsense 909 1329 22 29
ENSDART00000146705 Nonsense 909 1329 21 28
Genomic Location (Zv9):
Chromosome 2 (position 48335623)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 48367287
GRCz11 2 48221451
KASP Assay ID:
2259-2654.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAGGCTGGAGGAGGAGGCTGCGGCCGCTGCAGCAGCACTGCTCAGACAA[C/T]AGCAGGAGGAGCAGAAGAAGAGAGAGCAGGAGGCGCAGAGACAGCAGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19880
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056277 Nonsense 923 1329 22 29
ENSDART00000146705 Nonsense 923 1329 21 28
Genomic Location (Zv9):
Chromosome 2 (position 48335581)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 48367245
GRCz11 2 48221409
KASP Assay ID:
2259-2653.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAGACAACAGCAGGAGGAGCAGAAGAAGAGAGAGCAGGAGGCGCAGAGA[C/T]AGCAGGAGCTGCAGAGACAGAGACAGCAGCAACAGGAGGCACTCCGACGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10322
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056277 Nonsense 1296 1329 28 29
ENSDART00000146705 Nonsense 1296 1329 27 28
Genomic Location (Zv9):
Chromosome 2 (position 48321466)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 48353130
GRCz11 2 48207294
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCAGCANNNNNNACAGCAGCGGTTTGAAACRGTCACTTCCGGCAAGAAGAAGAAR[A/T]AACAGAAGATGGTACGAGCCGACCCAAGCCTTCTAGGTGAGTCATACATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link