
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
daam1b
- Ensembl ID:
- ENSDARG00000009689
- ZFIN ID:
- ZDB-GENE-030131-4212
- Description:
- si:ch211-87i20.1 [Source:RefSeq peptide;Acc:NP_001025307]
- Human Orthologue:
- DAAM1
- Human Description:
- dishevelled associated activator of morphogenesis 1 [Source:HGNC Symbol;Acc:18142]
- Mouse Orthologue:
- Daam1
- Mouse Description:
- dishevelled associated activator of morphogenesis 1 Gene [Source:MGI Symbol;Acc:MGI:1914596]
Alleles
There are 4 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa45695 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa32288 | Nonsense | Available for shipment | Available now |
sa300 | Nonsense | F2 line generated | During 2018 |
sa23682 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa45695
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000004984 | Nonsense | 93 | 1079 | 3 | 25 |
ENSDART00000109084 | Nonsense | 93 | 1069 | 3 | 24 |
The following transcripts of ENSDARG00000009689 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 20 (position 21955186)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 21983353 GRCz11 20 21883026 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GTTATTCTTTATTTTTTTAATCGCATACACTTTACGTTTCTTTTTAGGAA[C/T]AAGAGGAGAATAAAGGTGCTACTAGCTGGCCGGAGTTCTACATCGACCAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa32288
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000004984 | Nonsense | 132 | 1079 | 4 | 25 |
ENSDART00000109084 | Nonsense | 132 | 1069 | 4 | 24 |
The following transcripts of ENSDARG00000009689 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 20 (position 21951975)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 21980142 GRCz11 20 21879815 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGAGGAAGACTCTGTTGGCCTTGGAGAAGGAAGAAGAGGAGGAACGCAAC[A/T]AGACCATTGAAAGCCTTAAAACGGCACTGCGAACACAACCCATGAGGTCT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa300
- Current Status:
-
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000004984 | Nonsense | 485 | 1079 | 12 | 25 |
ENSDART00000109084 | Nonsense | 485 | 1069 | 12 | 24 |
ENSDART00000004984 | Nonsense | 485 | 1079 | 12 | 25 |
ENSDART00000109084 | Nonsense | 485 | 1069 | 12 | 24 |
The following transcripts of ENSDARG00000009689 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 20 (position 21937474)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 21965641 GRCz11 20 21865314 - KASP Assay ID:
- 554-3271.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AGAAGGAGCGAGAGTGTGACGCCAAAACACAGGAGAAGGAGGAGATGATG[C/T]AGACCCTCAACAAGATGAAAGAGAAGTTAGAAAGAGAAATGGGGGAACAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa23682
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000004984 | Essential Splice Site | 953 | 1079 | 24 | 25 |
ENSDART00000109084 | Essential Splice Site | 943 | 1069 | 23 | 24 |
The following transcripts of ENSDARG00000009689 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 20 (position 21891309)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 21919476 GRCz11 20 21819149 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGGATTTATGTTGAAAATGGCTCTCATACGAGTTCTGCTTCTGTTCTCTA[G/A]TTCATCAAGACAGTCAAGCACTTCGGTGAGGACGCTGATAAGATGCAGCC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: