unc119.1

Ensembl ID:
ENSDARG00000009629
ZFIN ID:
ZDB-GENE-030219-130
Description:
Protein unc-119 homolog B [Source:UniProtKB/Swiss-Prot;Acc:Q90Z08]
Human Orthologue:
UNC119B
Human Description:
unc-119 homolog B (C. elegans) [Source:HGNC Symbol;Acc:16488]
Mouse Orthologue:
Unc119b
Mouse Description:
unc-119 homolog B (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:2147162]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34459 Nonsense Mutation detected in F1 DNA During 2018
sa34458 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa34459
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019907 Nonsense 91 243 2 5

The following transcripts of ENSDARG00000009629 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 41810866)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 39824446
GRCz11 8 39858220
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGACTATTTGTGTAAACTAGAGGACAACATCTACAATATTGACTTTACA[C/T]GATTTAAGATCCGAGACCTGGAGACTGGGACAGTGCTTTTTGAGATTGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34458
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019907 Essential Splice Site 113 243 None 5

The following transcripts of ENSDARG00000009629 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 41808815)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 39822395
GRCz11 8 39856169
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAAATGTTGCTTTGACAACTAGCTAAAGTAATTGTTTGTTTGTTCTTTC[A/T]GACCTTGATGAAGAGGACGATGAAAACCGAGACGCTGACACCAGTGCGGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link