
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
unc119.1
- Ensembl ID:
- ENSDARG00000009629
- ZFIN ID:
- ZDB-GENE-030219-130
- Description:
- Protein unc-119 homolog B [Source:UniProtKB/Swiss-Prot;Acc:Q90Z08]
- Human Orthologue:
- UNC119B
- Human Description:
- unc-119 homolog B (C. elegans) [Source:HGNC Symbol;Acc:16488]
- Mouse Orthologue:
- Unc119b
- Mouse Description:
- unc-119 homolog B (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:2147162]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa34459 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa34458 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa34459
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000019907 | Nonsense | 91 | 243 | 2 | 5 |
The following transcripts of ENSDARG00000009629 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 8 (position 41810866)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 39824446 GRCz11 8 39858220 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CAGACTATTTGTGTAAACTAGAGGACAACATCTACAATATTGACTTTACA[C/T]GATTTAAGATCCGAGACCTGGAGACTGGGACAGTGCTTTTTGAGATTGCC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa34458
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > T
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000019907 | Essential Splice Site | 113 | 243 | None | 5 |
The following transcripts of ENSDARG00000009629 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 8 (position 41808815)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 39822395 GRCz11 8 39856169 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGAAATGTTGCTTTGACAACTAGCTAAAGTAATTGTTTGTTTGTTCTTTC[A/T]GACCTTGATGAAGAGGACGATGAAAACCGAGACGCTGACACCAGTGCGGG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: