zgc:194780

Ensembl ID:
ENSDARG00000009626
ZFIN ID:
ZDB-GENE-080724-1
Description:
nuclear receptor binding protein [Source:RefSeq peptide;Acc:NP_001124089]
Human Orthologue:
NRBP2
Human Description:
nuclear receptor binding protein 2 [Source:HGNC Symbol;Acc:19339]
Mouse Orthologue:
Nrbp2
Mouse Description:
nuclear receptor binding protein 2 Gene [Source:MGI Symbol;Acc:MGI:2385017]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37926 Essential Splice Site Mutation detected in F1 DNA During 2018
sa25217 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa37926
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128943 Essential Splice Site 81 504 2 18
Genomic Location (Zv9):
Chromosome 24 (position 34476472)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 33328292
GRCz11 24 33242712
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGGAACGAGGTTTTCTTCCAGGACAAGAAGGTCTTTAAGACAGTGGAG[G/A]TGAGTTCTTAAATAATAGTTTTAAGTTTACTAAAAGCTACTTTAAAAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25217
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128943 Nonsense 348 504 12 18
Genomic Location (Zv9):
Chromosome 24 (position 34468046)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 33319866
GRCz11 24 33234286
KASP Assay ID:
554-7755.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGAAAACCAAATCCTTCGACCCAAATGGAGTCATGGCAGAGATTATTTA[C/A]GGAGATCGTTCTCGCGTTCAGCTCAAGTAAGTCTCAACTTAAGCTACATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link