zgc:55406

Ensembl ID:
ENSDARG00000009612
ZFIN ID:
ZDB-GENE-040426-2891
Description:
hypothetical protein LOC406819 [Source:RefSeq peptide;Acc:NP_998378]
Human Orthologue:
OVGP1
Human Description:
oviductal glycoprotein 1, 120kDa [Source:HGNC Symbol;Acc:8524]
Mouse Orthologue:
Ovgp1
Mouse Description:
oviductal glycoprotein 1 Gene [Source:MGI Symbol;Acc:MGI:106661]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2585 Essential Splice Site F2 line generated During 2018
sa11562 Essential Splice Site Available for shipment Available now
sa12464 Nonsense Available for shipment Available now
sa11781 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa2585
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067817 Essential Splice Site 9 471 3 12
Genomic Location (Zv9):
Chromosome 11 (position 25041020)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 23778702
GRCz11 11 24016559
KASP Assay ID:
554-2496.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTCNTTTTTTTAATATATTTATTATTTACATAAAGTCATTTTGTTTCCT[A/G]GGTTTGAGCTTGGTGCTCTGCCATGTCGGTGAGTTTTTAACTACTTCTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11562
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067817 Essential Splice Site 243 471 8 12
Genomic Location (Zv9):
Chromosome 11 (position 25042367)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 23777355
GRCz11 11 24015212
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCTGTACCAAGGCTCAAAGGATGAGGGAGACCTKRTCTACTTCAACACC[G/A]TAAGAACTGAAATKAAMCTTATTTAGYATGGGATTTTCMCTCTCTCAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12464
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067817 Nonsense 468 471 12 12
ENSDART00000067817 Nonsense 468 471 12 12
Genomic Location (Zv9):
Chromosome 11 (position 25043425)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 23776297
GRCz11 11 24014154
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAATGTGCTGTAGGCACCGTGTTTGATGACAGCTKCAAGTGCTGTGTTT[G/A]GCCCAAACCTTAGTGATCATGACTCAARAAACTTCAGAAAAACATTTGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11781
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067817 Nonsense 468 471 12 12
ENSDART00000067817 Nonsense 468 471 12 12
Genomic Location (Zv9):
Chromosome 11 (position 25043425)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 23776297
GRCz11 11 24014154
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAATGTGCTGTAGGCACCGTGTTTGATGACAGCTKCAAGTGCTGTGTTT[G/A]GCCCAAACCTTAGTGATCATGACTCAARAAACTTCAGAAAAACATTTGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link