wu:fc13d03

Ensembl ID:
ENSDARG00000009610
ZFIN ID:
ZDB-GENE-030131-2614
Description:
Wu:fc13d03 protein [Source:UniProtKB/TrEMBL;Acc:A1L1W8]
Human Orthologues:
RGS10, RGS12
Human Descriptions:
regulator of G-protein signaling 10 [Source:HGNC Symbol;Acc:9992]
regulator of G-protein signaling 12 [Source:HGNC Symbol;Acc:9994]
Mouse Orthologues:
Rgs10, Rgs12
Mouse Descriptions:
regulator of G-protein signaling 12 Gene [Source:MGI Symbol;Acc:MGI:1918979]
regulator of G-protein signalling 10 Gene [Source:MGI Symbol;Acc:MGI:1915115]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa45272 Essential Splice Site Mutation detected in F1 DNA During 2018
sa11943 Essential Splice Site Available for shipment Available now
sa18866 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45272
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040534 Essential Splice Site 1008 1370 11 17
Genomic Location (Zv9):
Chromosome 7 (position 19712790)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 18245819
GRCz11 7 18498086
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTACTCTCAGCTCCAGGGAACTTCGTCTTGAGAAGCGCACTTTGTTCAG[G/A]TACGTTTTGTTATTATTATCTTCCTTTCGCAAGCAATATCTGGAACTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11943
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040534 Essential Splice Site 1008 1370 11 17
ENSDART00000040534 Essential Splice Site 1008 1370 11 17
Genomic Location (Zv9):
Chromosome 7 (position 19712789)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 18245818
GRCz11 7 18498085
KASP Assay ID:
2259-8610.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTACTCTCAGCTCCAGGGAACTTCRTCTTGARAAGCGCACTTTGTTYAGG[T/C]ACGTTTTGTTATTATTATCTTCCTTTCGCAARCAATATCTGGAACTATTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18866
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040534 Essential Splice Site 1008 1370 11 17
ENSDART00000040534 Essential Splice Site 1008 1370 11 17
Genomic Location (Zv9):
Chromosome 7 (position 19712789)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 18245818
GRCz11 7 18498085
KASP Assay ID:
2259-8610.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTACTCTCAGCTCCAGGGAACTTCGTCTTGAGAAGCGCACTTTGTTCAGG[T/C]ACGTTTTGTTATTATTATCTTCCTTTCGCAAGCAATATCTGGAACTATTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link