
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
nr1d2b
- Ensembl ID:
- ENSDARG00000009594
- ZFIN ID:
- ZDB-GENE-990415-244
- Description:
- nuclear receptor subfamily 1 group D member 2 [Source:RefSeq peptide;Acc:NP_571140]
- Human Orthologue:
- NR1D2
- Human Description:
- nuclear receptor subfamily 1, group D, member 2 [Source:HGNC Symbol;Acc:7963]
- Mouse Orthologue:
- Nr1d2
- Mouse Description:
- nuclear receptor subfamily 1, group D, member 2 Gene [Source:MGI Symbol;Acc:MGI:2449205]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa36820 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa5921 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa36820
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000127353 | Nonsense | 67 | 578 | 2 | 8 |
The following transcripts of ENSDARG00000009594 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 19 (position 19390480)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 19 17943615 GRCz11 19 17402180 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTCATGTGGCCTCTCATTCTCGCCCACCAAGGCATGGTGGAGGGAAAGCA[C/T]GATCACTCTCCTCCACCAAAAGTGGCATTACAAGTAAGTGACTATATTAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa5921
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000127353 | Nonsense | 311 | 578 | 5 | 8 |
The following transcripts of ENSDARG00000009594 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 19 (position 19392567)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 19 17945702 GRCz11 19 17404267 - KASP Assay ID:
- 554-3777.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AGACTCAGGAGGTCTTGAACYACCAGAACAATGTGTCCTCAGTAAGTGAA[C/T]AGAATCCACAGTCGAGCTGTGGTCCACAGGGTCCTGAAGACTCTGGTCAA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: