slc1a2b

Ensembl ID:
ENSDARG00000009563
ZFIN IDs:
ZDB-GENE-030131-7779, ZDB-GENE-030131-7779, ZDB-GENE-040718-414, ZDB-GENE-040718-414
Description:
excitatory amino acid transporter 2 [Source:RefSeq peptide;Acc:NP_956273]
Human Orthologue:
SLC1A2
Human Description:
solute carrier family 1 (glial high affinity glutamate transporter), member 2 [Source:HGNC Symbol;Ac
Mouse Orthologue:
Slc1a2
Mouse Description:
solute carrier family 1 (glial high affinity glutamate transporter), member 2 Gene [Source:MGI Symbo

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa15717 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15717
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039375 Nonsense 500 561 9 10
ENSDART00000124541 Nonsense 500 561 10 11
Genomic Location (Zv9):
Chromosome 25 (position 38410546)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 36832604
GRCz11 25 37403162
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGCAGAGCTGGACGCTCTGGACGCCCAGCACGGGAAGACTGACGACATC[G/T]AGATGATGACCAAGACCCAGTCCTACTATGATGACCTCAAAAACCATCWT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link