wdr8

Ensembl ID:
ENSDARG00000009557
ZFIN ID:
ZDB-GENE-030131-6313
Description:
WD repeat-containing protein 8 [Source:RefSeq peptide;Acc:NP_956187]
Human Orthologue:
WDR8
Human Description:
WD repeat domain 8 [Source:HGNC Symbol;Acc:12759]
Mouse Orthologue:
Wdr8
Mouse Description:
WD repeat domain 8 Gene [Source:MGI Symbol;Acc:MGI:1891749]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12282 Nonsense Available for shipment Available now
sa34492 Nonsense Mutation detected in F1 DNA During 2018
sa18442 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12282
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010591 Nonsense 131 446 5 13
ENSDART00000122458 Nonsense 131 446 5 13
Genomic Location (Zv9):
Chromosome 8 (position 51096317)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 48847361
GRCz11 8 48836130
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAATCACTGTCTGGTCCCTATGCACAAAATCCGTATCATACATCAAATA[T/A]CCCAAAGCCTGCCAGAAAGGTGAGTTSAYGTGAGCTAGCGTCTAATAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34492
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010591 Nonsense 152 446 6 13
ENSDART00000122458 Nonsense 152 446 6 13
Genomic Location (Zv9):
Chromosome 8 (position 51092214)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 48843258
GRCz11 8 48832027
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGTTTCAGGCATGGACTTCACTGCAGATGGCCGTTATATGGCGCTGGCA[G/T]AGAGACGGGATTGTAAGGACTACATCAGTGTGTTTGTATGTGACGACTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18442
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010591 Nonsense 156 446 6 13
ENSDART00000122458 Nonsense 156 446 6 13
Genomic Location (Zv9):
Chromosome 8 (position 51092200)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 48843244
GRCz11 8 48832013
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACTTCACTGCAGATGGSCGTTAYATGGCGCTGGCAGAGAGACGGGATTG[T/A]AARGACTACATCAGTGTRTTWGTATGTGACGACKGGCATCTGCTCAGAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link