si:dkey-7c22.2

Ensembl ID:
ENSDARG00000009549
ZFIN ID:
ZDB-GENE-090313-341
Description:
Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:Q98SN0]
Human Orthologue:
UBR4
Human Description:
ubiquitin protein ligase E3 component n-recognin 4 [Source:HGNC Symbol;Acc:30313]
Mouse Orthologue:
Ubr4
Mouse Description:
ubiquitin protein ligase E3 component n-recognin 4 Gene [Source:MGI Symbol;Acc:MGI:1916366]

Alleles

There are 20 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1352 Essential Splice Site Confirmed mutation in F2 line During 2018
sa24308 Essential Splice Site Available for shipment Available now
sa18557 Essential Splice Site Available for shipment Available now
sa24309 Essential Splice Site Available for shipment Available now
sa24310 Essential Splice Site Available for shipment Available now
sa24311 Nonsense Available for shipment Available now
sa17768 Splice Site, Nonsense Available for shipment Available now
sa10455 Nonsense Available for shipment Available now
sa10225 Nonsense Available for shipment Available now
sa43965 Nonsense Mutation detected in F1 DNA During 2018
sa45795 Nonsense Mutation detected in F1 DNA During 2018
sa18073 Nonsense Available for shipment Available now
sa18017 Nonsense Available for shipment Available now
sa3235 Nonsense F2 line generated During 2018
sa6733 Nonsense Mutation detected in F1 DNA During 2018
sa37687 Nonsense Mutation detected in F1 DNA During 2018
sa17134 Splice Site, Nonsense Available for shipment Available now
sa18331 Nonsense Available for shipment Available now
sa16066 Nonsense Available for shipment Available now
sa37688 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa1352
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024846 Essential Splice Site 40 5152 1 105
ENSDART00000033970 Essential Splice Site 28 5129 1 104

The following transcripts of ENSDARG00000009549 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 21573216)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 21352523
GRCz11 23 21279074
KASP Assay ID:
554-1266.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTTCGAAACGAAAGAGCTACCTCAGCTTATAGGATCCATCATAAACAGG[T/G]CAGAYGAGGGCTTGTTTGTTTAGTTGGCCCGTGCGGGTCTGAAATAAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24308
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024846 Essential Splice Site 107 5152 3 105
ENSDART00000033970 Essential Splice Site 95 5129 3 104

The following transcripts of ENSDARG00000009549 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 21578917)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 21358224
GRCz11 23 21284775
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCATTGCTGCGTCTGGAGAATCCTGATGAAGCATGTGCAGTCTCTCAGG[T/G]CAGACTTTCACCTTTTAAGCAGAAAACAGTTTGATTGTTTGATTAAGCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18557
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024846 Essential Splice Site 321 5152 8 105
ENSDART00000033970 Essential Splice Site 309 5129 8 104

The following transcripts of ENSDARG00000009549 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 21585693)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 21365000
GRCz11 23 21291551
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGAGACTACTTGATGTGACTGTGTTAGCACTAAGCTGCCTCTAYGCAGG[T/C]GGGTTCATTTGGGAAAAAAATCTGTTCTTGTTGAYYTCAGAGGAAAACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24309
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024846 Essential Splice Site 382 5152 10 105
ENSDART00000033970 Essential Splice Site 370 5129 10 104

The following transcripts of ENSDARG00000009549 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 21587892)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 21367199
GRCz11 23 21293750
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGAGATGATTGGACAGGCCATCAGTAACTCTCGCAGAGCTGGAGGAGAG[G/A]TAGAAATATTATTTTACAGAGTATATACATATAACATGAAAGGAAAGTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24310
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024846 Essential Splice Site 709 5152 None 105
ENSDART00000033970 Essential Splice Site 696 5129 None 104

The following transcripts of ENSDARG00000009549 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 21597619)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 21376926
GRCz11 23 21303477
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTTAATCACTCTCTGGTTACATCAGACCTGCCCTCTCCATCCCTGCAGG[T/A]AAAGTTGAGATATTCTTTAAAACGTATTCAAAATTTGTGACAGACATATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24311
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024846 Nonsense 745 5152 18 105
ENSDART00000033970 Nonsense 732 5129 18 104

The following transcripts of ENSDARG00000009549 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 21597812)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 21377119
GRCz11 23 21303670
KASP Assay ID:
2261-7624.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTACATCCACCCTCAGTCTCTCTCAGTGCTCTCCAGGTTGCTGCTGATTT[G/A]GCAACATAAAGCCAGTCAGCAGGGGGAGCCTGATGTACCCGAGTGCATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17768
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024846 Splice Site, Nonsense 859 5152 19 105
ENSDART00000033970 Splice Site, Nonsense 846 5129 19 104

The following transcripts of ENSDARG00000009549 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 21600317)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 21379624
GRCz11 23 21306175
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGACTACCTGCTRCACCAGTACTCAAAAGCTCCCGTCTACTTGTTTGAG[C/T]AGGTACGAATGCTAATGTKGCTGTATKTTAACTGRAATCAAGCCACTGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10455
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024846 Nonsense 1175 5152 26 105
ENSDART00000033970 Nonsense 1162 5129 26 104

The following transcripts of ENSDARG00000009549 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 21607822)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 21387129
GRCz11 23 21313680
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGCCAGAGGAAGGAGAAAACAAGCCCACTGAAGCTAAACTGCAGGGCTA[T/A]GCTGCCGTGTTGTCCATTGGATCTACGCGCTGCAAAGCCAACTTGCTTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10225
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024846 Nonsense 1547 5152 33 105
ENSDART00000033970 Nonsense 1534 5129 33 104

The following transcripts of ENSDARG00000009549 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 21611572)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 21390879
GRCz11 23 21317430
KASP Assay ID:
2261-7628.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTAAAACTAAATCCAACTTTTTCCTATTTATCTTTCAGTAAAAAATACT[T/A]GTATCAGAAGAACGTTGTGGAGAAAGTAACAGCCAACGTGTCACAAGGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43965
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024846 Nonsense 1842 5152 39 105
ENSDART00000033970 Nonsense 1829 5129 39 104

The following transcripts of ENSDARG00000009549 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 21620027)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 21399334
GRCz11 23 21325885
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAAAATTGCTTAATGTGTTTTTATCCTCCAGGTTCCAACACTGGGCTCA[C/T]AAGAGGGTGCTTTTGAAAATGTCAGGATGAACTACAGTGGAGATCAAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45795
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024846 Nonsense 2202 5152 45 105
ENSDART00000033970 Nonsense 2189 5129 45 104

The following transcripts of ENSDARG00000009549 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 21624950)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 21404257
GRCz11 23 21330808
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCAGATTCAGGACATGGTTGCGATCCGTCACACAGCTAGCAACGAGCAG[C/T]AGCGCACAACCATGATTCTGCTGTGTGAGGATGGCAGCCTTCGTATTTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18073
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024846 Nonsense 2288 5152 46 105
ENSDART00000033970 Nonsense 2275 5129 46 104

The following transcripts of ENSDARG00000009549 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 21625292)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 21404599
GRCz11 23 21331150
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGCAGCTGACAGAGGTGGAGTTTGGAGGCAATGACCTTCTGCAGGTCTA[C/A]AATGGCCAAYAAATCAAACATMGSCTGAACTCTACAGGGATGTATGTGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18017
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024846 Nonsense 2292 5152 46 105
ENSDART00000033970 Nonsense 2279 5129 46 104

The following transcripts of ENSDARG00000009549 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 21625302)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 21404609
GRCz11 23 21331160
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGAGGTGGAGTTTGGAGGCAATGACCTTCTGCAGGTCTAMAATGGCCAA[C/T]AAATCAAACATMGSCTGAACTCTACAGGGATGTATGTGGCCAACACCAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3235
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024846 Nonsense 2685 5152 54 105
ENSDART00000033970 Nonsense 2672 5129 54 104

The following transcripts of ENSDARG00000009549 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 21635456)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 21414763
GRCz11 23 21341314
KASP Assay ID:
554-3216.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGCTTGCAAACAGGCTCTGATTAGAGTACTTAGACCCAGGAATAAGCGC[A/T]GACATGTGACCTTACCATCGCCGCCTCGCTCCAACACACCCATGGGTATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6733
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024846 Nonsense 3249 5152 65 105
ENSDART00000033970 Nonsense 3223 5129 64 104

The following transcripts of ENSDARG00000009549 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 21644508)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 21423815
GRCz11 23 21350366
KASP Assay ID:
554-4538.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCCTGAGGGGCGGAATCGTGACTGCCACATCTGGCTCTGCTCTGCAGTA[C/A]GACACTCTGATTAGTCTGGTGAGTAGCGCTCTCAGCAGTCTTCTGTGACR
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37687
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024846 Nonsense 3402 5152 68 105
ENSDART00000033970 Nonsense 3376 5129 67 104

The following transcripts of ENSDARG00000009549 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 21646782)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 21426089
GRCz11 23 21352640
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTTTCTGCTGGAGTCCAATTCCTCATCTGTGCGCTGGCAAGCTCACTG[C/A]CTCACACTGCATATCTACAGGTACGTAAAATCAATTTTCTACCTTTGAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17134
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024846 Splice Site, Nonsense 3485 5152 70 105
ENSDART00000033970 Splice Site, Nonsense 3459 5129 69 104

The following transcripts of ENSDARG00000009549 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 21647334)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 21426641
GRCz11 23 21353192
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGAGGGCACAGAACCACATTCTGACCAATCACCCTAATTCAAACATATA[C/A]AAGTAAGTGTTCTCATCATTGGATGAAAATATTCTGCTTCACCGATGTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18331
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024846 Nonsense 3931 5152 78 105
ENSDART00000033970 Nonsense 3905 5129 77 104

The following transcripts of ENSDARG00000009549 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 21652620)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 21431927
GRCz11 23 21358478
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATGAATGATCTCATTATTGCCAAGGTGTCTGCAGCCCTTAAAGGACACT[G/A]GGCCAACCCTGATCTGGTATTTACCCTTTGTTATTGCATAGTAAGGATTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16066
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024846 Nonsense 4719 5152 97 105
ENSDART00000033970 Nonsense 4696 5129 96 104

The following transcripts of ENSDARG00000009549 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 21662167)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 21441474
GRCz11 23 21368025
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTCCTYCTTGTAGATGCTWATCGGAACAGATTCAATAACCAATTTGCAC[A/T]AGCTGGAGCAGGTGTCCAGCGACGAGGGTATCGGCACTTTAGCAGAGAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37688
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024846 Nonsense 4911 5152 101 105
ENSDART00000033970 Nonsense 4888 5129 100 104

The following transcripts of ENSDARG00000009549 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 21663724)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 21443031
GRCz11 23 21369582
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGTTGGAGTGTAAACTTGTTTTTTTACCATTTTACAGGCACAACACATA[T/A]CTGCAAGAGTGCACAGGGCAAAGGGAACCCACATACCAGCTCAACATTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link