wls

Ensembl ID:
ENSDARG00000009534
ZFIN IDs:
ZDB-GENE-040426-2161, ZDB-GENE-040426-2161
Description:
G protein-coupled receptor 177 [Source:RefSeq peptide;Acc:NP_998311]
Human Orthologue:
WLS
Human Description:
wntless homolog (Drosophila) [Source:HGNC Symbol;Acc:30238]
Mouse Orthologue:
Wls
Mouse Description:
wntless homolog (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1915401]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25762 Nonsense Mutation detected in F1 DNA During 2018
sa39773 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa25762
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016369 Nonsense 196 542 4 12
ENSDART00000130302 Nonsense 196 542 4 13
Genomic Location (Zv9):
Chromosome 2 (position 10152622)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 10577718
GRCz11 2 10361317
KASP Assay ID:
2259-1624.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGACCTGTTGCCCTTTATGGAGCTTGGCAGTGTGGCCCATAAGTACTA[T/A]CTTCTCAATGTCCGACTGCCTGTTAATGAACGAAAAAAGGTCAACATCGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39773
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016369 Essential Splice Site 325 542 6 12
ENSDART00000130302 Essential Splice Site 325 542 6 13
Genomic Location (Zv9):
Chromosome 2 (position 10145887)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 10570983
GRCz11 2 10354582
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCCATGCTGCTCTCCTTCTGGATCATCTTCTGTGGAGAGCACCTCATGG[T/C]AAGTGCCAGCTTTCTTGTTTGTTCAAATGTGGATCAATTGGTGCAGAATT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Bone mineral density: Genome-wide meta-analysis identifies 56 bone mineral density loci and reveals 14 loci associated with risk of fracture. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link