irx1a

Ensembl ID:
ENSDARG00000009510
ZFIN IDs:
ZDB-GENE-040707-1, ZDB-GENE-040707-1, ZDB-GENE-040707-1
Description:
iroquois-class homeodomain protein IRX-1 isoform 1 [Source:RefSeq peptide;Acc:NP_997067]
Human Orthologue:
IRX1
Human Description:
iroquois homeobox 1 [Source:HGNC Symbol;Acc:14358]
Mouse Orthologue:
Irx1
Mouse Description:
Iroquois related homeobox 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1197515]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24999 Nonsense Mutation detected in F1 DNA During 2018
sa15451 Essential Splice Site, Missense Available for shipment Available now
sa45558 Essential Splice Site Mutation detected in F1 DNA During 2018
sa42638 Missense, Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa24999
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006726 Nonsense 8 426 1 4
ENSDART00000044190 Nonsense 8 419 1 3
ENSDART00000082371 Nonsense 8 148 1 6
Genomic Location (Zv9):
Chromosome 16 (position 820834)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 737855
GRCz11 16 813803
KASP Assay ID:
554-7583.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTTGGCTTCCGACGTGGCGGAGGAGATGTCTTTCCCCCAGCTGGGCTA[C/A]CCGCAGTATTTAAGTGCCTCCCAGGCGGTGTACGGAGGCGACCGACCGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15451
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006726 Missense 406 426 3 4
ENSDART00000044190   None 419 None 3
ENSDART00000082371 Essential Splice Site 119 148 3 6
Genomic Location (Zv9):
Chromosome 16 (position 823481)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 740502
GRCz11 16 816450
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAAATGAATCRCCAACGCAACCTTTAAAGTCGTCGTTTCGTCCTCTTCA[T/A]GACAGGTAAATGTGCAYTATWCTCTCAGTTTTCCCTCCTCCTTCTTCATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45558
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006726   None 426 None 4
ENSDART00000044190   None 419 None 3
ENSDART00000082371 Essential Splice Site 121 148 4 6
Genomic Location (Zv9):
Chromosome 16 (position 823550)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 740571
GRCz11 16 816519
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATACTCTCAGTTTTCCCTCCTCCTTCTTCATATTTTGTTATTTTTTATTA[G/A]TAGCAGTAAGCTATCATTATACAAGATGAAGTGGCTGTTTTTAAAACTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42638
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Missense, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006726 Missense 417 426 4 4
ENSDART00000044190 Nonsense 393 419 3 3
ENSDART00000082371   None 148 None 6
Genomic Location (Zv9):
Chromosome 16 (position 824488)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 741509
GRCz11 16 817457
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGCATCTCTTTTTCTCTCCACAGTCCCAGAAACCAGCAGGAATCAACAC[A/T]GAGGGTCCTCACAGCGCTGTCCTCCGCTTGATCAACACATTTGCACCCCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link