nid2b

Ensembl ID:
ENSDARG00000009471
ZFIN ID:
ZDB-GENE-040724-143
Description:
Novel protein similar to nidogen 2 (Osteonidogen) (NID2) [Source:UniProtKB/TrEMBL;Acc:Q5RI93]
Human Orthologue:
NID2
Human Description:
nidogen 2 (osteonidogen) [Source:HGNC Symbol;Acc:13389]
Mouse Orthologue:
Nid2
Mouse Description:
nidogen 2 Gene [Source:MGI Symbol;Acc:MGI:1298229]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7479 Missense Mutation detected in F1 DNA During 2018
sa23644 Nonsense Available for shipment Available now
sa45690 Essential Splice Site Mutation detected in F1 DNA During 2018
sa36981 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa7479
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023809 Missense 405 1135 7 23
ENSDART00000134097 Missense 397 1116 5 18
Genomic Location (Zv9):
Chromosome 20 (position 9844848)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 9676777
GRCz11 20 9664017
KASP Assay ID:
554-4088.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGTGTGGACCTCCATGGCTTTGCGGTGGTGGGAGAARGTCGTGTGTATR[T/A]CTCCATCAGTCCTGTCCCARCTMGGGTGGGCTGGGCTCTGATGGCTGTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23644
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023809 Nonsense 480 1135 8 23
ENSDART00000134097 Nonsense 472 1116 6 18
Genomic Location (Zv9):
Chromosome 20 (position 9844549)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 9676478
GRCz11 20 9663718
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCGTGTTGTCATTATTCAAGAGGCTCAAGGAATGGATTCATTCAACCACT[T/A]GAATTTTGACATTAACATCATTGGAGATTTACCTAGCATTCCCAGTGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45690
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023809 Essential Splice Site 850 1135 18 23
ENSDART00000134097   None 1116 None 18
Genomic Location (Zv9):
Chromosome 20 (position 9830828)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 9662757
GRCz11 20 9649997
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGCCAAAATGTCCAGCCCTGGTTTTAATGTCTCTTCTTTTCACCTGTCA[G/A]GTATATCTGGTGATGCCGCCCCACTCAACAATGCACTGATGTATCCGGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36981
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023809 Nonsense 1109 1135 23 23
ENSDART00000134097 Nonsense 1091 1116 18 18
Genomic Location (Zv9):
Chromosome 20 (position 9824980)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 9656909
GRCz11 20 9644149
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATATTAACAATGAGAATGTCTGTATAGAGATGGGATACTGGTGATTGAC[C/T]AAAGCACAGGGAAAAACACAGATTATCTGCCCATTCAGCAGTCACACTTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link