Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:92137
- Ensembl ID:
- ENSDARG00000009443
- ZFIN ID:
- ZDB-GENE-040801-179
- Description:
- hypothetical protein LOC445049 [Source:RefSeq peptide;Acc:NP_001003729]
- Human Orthologues:
- AMY1A, AMY1B, AMY1C, AMY2A, AMY2B
- Human Descriptions:
- amylase, alpha 1A (salivary) [Source:HGNC Symbol;Acc:474]
- amylase, alpha 1B (salivary) [Source:HGNC Symbol;Acc:475]
- amylase, alpha 1C (salivary) [Source:HGNC Symbol;Acc:476]
- amylase, alpha 2A (pancreatic) [Source:HGNC Symbol;Acc:477]
- amylase, alpha 2B (pancreatic) [Source:HGNC Symbol;Acc:478]
- Mouse Orthologues:
- Amy1, Amy2a1, Amy2a2, Amy2a3, Amy2a4, Amy2a5
- Mouse Descriptions:
- amylase 1, salivary Gene [Source:MGI Symbol;Acc:MGI:88019]
- amylase 2a1 Gene [Source:MGI Symbol;Acc:MGI:104548]
- amylase 2a2 Gene [Source:MGI Symbol;Acc:MGI:3711220]
- amylase 2a3 Gene [Source:MGI Symbol;Acc:MGI:3714985]
- amylase 2a4 Gene [Source:MGI Symbol;Acc:MGI:3711258]
- amylase 2a5 Gene [Source:MGI Symbol;Acc:MGI:88020]
Alleles
There are 5 alleles of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa19184 | Nonsense | Mutation detected in F1 DNA | During 2018 |
| sa9334 | Nonsense | Mutation detected in F1 DNA | During 2018 |
| sa42986 | Nonsense | Mutation detected in F1 DNA | During 2018 |
| sa11021 | Nonsense | Available for shipment | Available now |
| sa19185 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa19184
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000024558 | Nonsense | 52 | 512 | 1 | 10 |
| ENSDART00000024558 | Nonsense | 52 | 512 | 1 | 10 |
- Genomic Location (Zv9):
- Chromosome 17 (position 42998881)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 17 42711607 GRCz11 17 42988113 - KASP Assay ID:
- 2261-1450.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGGGCAGACATAGCTGAAGAATGCGAGAGATATCTGGCACCAAACGGCTA[T/A]GGAGGAGTTCAGGTGCGTTTGAAATGATTTCCATGACCATTGGGATTGTA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa9334
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000024558 | Nonsense | 52 | 512 | 1 | 10 |
| ENSDART00000024558 | Nonsense | 52 | 512 | 1 | 10 |
- Genomic Location (Zv9):
- Chromosome 17 (position 42998881)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 17 42711607 GRCz11 17 42988113 - KASP Assay ID:
- 2261-1450.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TGGGCAGACATAGCTGAAGAATGCGAGAGATATCTGGCACCAAACGGCTA[T/A]GGAGGAGTTCAGGTGCGTTTGAAATGATTTCCATGACCATTGGGATTGTA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa42986
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000024558 | Nonsense | 77 | 512 | 2 | 10 |
- Genomic Location (Zv9):
- Chromosome 17 (position 42999071)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 17 42711417 GRCz11 17 42987923 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGTGAACACGTCAAGCTGACCAATCCTTGGCATCCTTGGTGGCAGAGATA[T/A]CAACCAATCAGCTATAACCTGTGCTCCAGATCAGGAACTGAAGCAGAACT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa11021
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000024558 | Nonsense | 482 | 512 | 10 | 10 |
| ENSDART00000024558 | Nonsense | 482 | 512 | 10 | 10 |
- Genomic Location (Zv9):
- Chromosome 17 (position 43002876)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 17 42707612 GRCz11 17 42984118 - KASP Assay ID:
- 2261-1451.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- ACTGTGACATCATCTCTGGAGAAAAGAGTGGGAAYAGTTGCACAGGGAAA[C/T]AGGTGTCAGTGGATTCTGATGGAAAAGCCACCTTCAGCATMAGCCACACA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa19185
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000024558 | Nonsense | 482 | 512 | 10 | 10 |
| ENSDART00000024558 | Nonsense | 482 | 512 | 10 | 10 |
- Genomic Location (Zv9):
- Chromosome 17 (position 43002876)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 17 42707612 GRCz11 17 42984118 - KASP Assay ID:
- 2261-1451.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ACTGTGACATCATCTCTGGAGAAAAGAGTGGGAACAGTTGCACAGGGAAA[C/T]AGGTGTCAGTGGATTCTGATGGAAAAGCCACCTTCAGCATCAGCCACACA
- Associated Phenotype:
- Not determined
OMIM
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
