zgc:92137

Ensembl ID:
ENSDARG00000009443
ZFIN ID:
ZDB-GENE-040801-179
Description:
hypothetical protein LOC445049 [Source:RefSeq peptide;Acc:NP_001003729]
Human Orthologues:
AMY1A, AMY1B, AMY1C, AMY2A, AMY2B
Human Descriptions:
amylase, alpha 1A (salivary) [Source:HGNC Symbol;Acc:474]
amylase, alpha 1B (salivary) [Source:HGNC Symbol;Acc:475]
amylase, alpha 1C (salivary) [Source:HGNC Symbol;Acc:476]
amylase, alpha 2A (pancreatic) [Source:HGNC Symbol;Acc:477]
amylase, alpha 2B (pancreatic) [Source:HGNC Symbol;Acc:478]
Mouse Orthologues:
Amy1, Amy2a1, Amy2a2, Amy2a3, Amy2a4, Amy2a5
Mouse Descriptions:
amylase 1, salivary Gene [Source:MGI Symbol;Acc:MGI:88019]
amylase 2a1 Gene [Source:MGI Symbol;Acc:MGI:104548]
amylase 2a2 Gene [Source:MGI Symbol;Acc:MGI:3711220]
amylase 2a3 Gene [Source:MGI Symbol;Acc:MGI:3714985]
amylase 2a4 Gene [Source:MGI Symbol;Acc:MGI:3711258]
amylase 2a5 Gene [Source:MGI Symbol;Acc:MGI:88020]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19184 Nonsense Mutation detected in F1 DNA During 2018
sa9334 Nonsense Mutation detected in F1 DNA During 2018
sa42986 Nonsense Mutation detected in F1 DNA During 2018
sa11021 Nonsense Available for shipment Available now
sa19185 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa19184
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024558 Nonsense 52 512 1 10
ENSDART00000024558 Nonsense 52 512 1 10
Genomic Location (Zv9):
Chromosome 17 (position 42998881)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 42711607
GRCz11 17 42988113
KASP Assay ID:
2261-1450.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGGCAGACATAGCTGAAGAATGCGAGAGATATCTGGCACCAAACGGCTA[T/A]GGAGGAGTTCAGGTGCGTTTGAAATGATTTCCATGACCATTGGGATTGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9334
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024558 Nonsense 52 512 1 10
ENSDART00000024558 Nonsense 52 512 1 10
Genomic Location (Zv9):
Chromosome 17 (position 42998881)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 42711607
GRCz11 17 42988113
KASP Assay ID:
2261-1450.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGGCAGACATAGCTGAAGAATGCGAGAGATATCTGGCACCAAACGGCTA[T/A]GGAGGAGTTCAGGTGCGTTTGAAATGATTTCCATGACCATTGGGATTGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42986
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024558 Nonsense 77 512 2 10
Genomic Location (Zv9):
Chromosome 17 (position 42999071)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 42711417
GRCz11 17 42987923
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTGAACACGTCAAGCTGACCAATCCTTGGCATCCTTGGTGGCAGAGATA[T/A]CAACCAATCAGCTATAACCTGTGCTCCAGATCAGGAACTGAAGCAGAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11021
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024558 Nonsense 482 512 10 10
ENSDART00000024558 Nonsense 482 512 10 10
Genomic Location (Zv9):
Chromosome 17 (position 43002876)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 42707612
GRCz11 17 42984118
KASP Assay ID:
2261-1451.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTGTGACATCATCTCTGGAGAAAAGAGTGGGAAYAGTTGCACAGGGAAA[C/T]AGGTGTCAGTGGATTCTGATGGAAAAGCCACCTTCAGCATMAGCCACACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19185
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024558 Nonsense 482 512 10 10
ENSDART00000024558 Nonsense 482 512 10 10
Genomic Location (Zv9):
Chromosome 17 (position 43002876)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 42707612
GRCz11 17 42984118
KASP Assay ID:
2261-1451.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTGTGACATCATCTCTGGAGAAAAGAGTGGGAACAGTTGCACAGGGAAA[C/T]AGGTGTCAGTGGATTCTGATGGAAAAGCCACCTTCAGCATCAGCCACACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link