vcanb

Ensembl ID:
ENSDARG00000009401
ZFIN ID:
ZDB-GENE-030131-2185
Description:
versican b [Source:RefSeq peptide;Acc:NP_999853]
Human Orthologue:
VCAN
Human Description:
versican [Source:HGNC Symbol;Acc:2464]
Mouse Orthologue:
Vcan
Mouse Description:
versican Gene [Source:MGI Symbol;Acc:MGI:102889]

Alleles

There are 10 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2565 Nonsense F2 line generated During 2018
sa27680 Essential Splice Site Mutation detected in F1 DNA During 2018
sa31805 Nonsense Available for shipment Available now
sa34986 Nonsense Mutation detected in F1 DNA During 2018
sa17214 Nonsense Available for shipment Available now
sa41736 Essential Splice Site Mutation detected in F1 DNA During 2018
sa41737 Nonsense Mutation detected in F1 DNA During 2018
sa923 Nonsense Available for shipment Available now
sa8831 Nonsense Mutation detected in F1 DNA During 2018
sa847 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa2565
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012522 Nonsense 96 1570 2 14
ENSDART00000134304 Nonsense 95 1569 3 15
ENSDART00000012522 Nonsense 96 1570 2 14
ENSDART00000134304 Nonsense 95 1569 3 15
Genomic Location (Zv9):
Chromosome 10 (position 44672958)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 43366608
GRCz11 10 43194988
KASP Assay ID:
554-3258.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGGGGAAGCCGTCGCTGTGGTGGCCCAGAACGGCATCATCAAAATGGGC[C/T]AAGAGTATATGGGCCGGGTGTCAGTGCCCAGCCGACCGGAAGACCAAGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27680
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012522 Essential Splice Site 208 1570 3 14
ENSDART00000134304 Essential Splice Site 207 1569 4 15
Genomic Location (Zv9):
Chromosome 10 (position 44682405)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 43376093
GRCz11 10 43204473
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGGATTCGAGCAGTGTGACGCCGGATGGATGGCCGACCAAACCGTCAGG[T/C]GATAAAACTGTACAATACATACAGTTGAAGACTGTATTATTTTTTCCCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31805
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012522 Nonsense 826 1570 7 14
ENSDART00000134304 Nonsense 825 1569 8 15
Genomic Location (Zv9):
Chromosome 10 (position 44709219)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 43402807
GRCz11 10 43231187
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGCAACCATGAGTGAATTGCCCATATTTTCAACCAAATCTCCAAGCCAG[G/T]AGATAACCCCACAAGCCATATCATTTAGCACATCAATCAATGAAGAAAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34986
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012522 Nonsense 946 1570 7 14
ENSDART00000134304 Nonsense 945 1569 8 15
Genomic Location (Zv9):
Chromosome 10 (position 44709579)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 43403167
GRCz11 10 43231547
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGGTTCCACCTCAGCAGAAGAAGAGAGCTCTGGACAAGATATGTATTCT[C/T]GAGAGGAACCAAAACAACCGATTTTATCTCCAACTCTCTCTGTTCCTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17214
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012522 Nonsense 1231 1570 7 14
ENSDART00000134304 Nonsense 1230 1569 8 15
Genomic Location (Zv9):
Chromosome 10 (position 44710434)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 43404022
GRCz11 10 43232402
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGACTGTTGTAGATTATGAAGATRTGCAGGGTGCCTCAGTTGTTGAAAGA[C/T]AAYCACCAATCAGGGAAGAGTTCACCACAAAWAAGCCAGAGGTCTGGACY
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41736
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012522 Essential Splice Site 1338 1570 10 14
ENSDART00000134304 Essential Splice Site 1337 1569 11 15
Genomic Location (Zv9):
Chromosome 10 (position 44726467)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 43420055
GRCz11 10 43248435
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCATTCAAATGTTAGTTTCTTATATCTCGATGTCTCTCATTTGAACTTTC[A/T]GATACGGAGGTGTGCGACTTTGGTTGGCAGAAGTTTCAGAGCCACTGCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41737
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012522 Nonsense 1346 1570 10 14
ENSDART00000134304 Nonsense 1345 1569 11 15
Genomic Location (Zv9):
Chromosome 10 (position 44726494)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 43420082
GRCz11 10 43248462
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGATGTCTCTCATTTGAACTTTCAGATACGGAGGTGTGCGACTTTGGTTG[G/A]CAGAAGTTTCAGAGCCACTGCTATAAGTACTTCACCCACCGGCGGACATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa923
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012522 Nonsense 1375 1570 10 14
ENSDART00000134304 Nonsense 1374 1569 11 15
Genomic Location (Zv9):
Chromosome 10 (position 44726579)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 43420167
GRCz11 10 43248547
KASP Assay ID:
554-0829.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCACCGGCGGACRTGGGAGGCAGCAGAAAGAGAGTGTCGTCTGCAGGGC[G/T]GACACCTGACCAGCGTCCTGTCCCACGAGGAGCAGCTCTTCGTAAATCGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8831
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012522 Nonsense 1443 1570 12 14
ENSDART00000134304 Nonsense 1442 1569 13 15
Genomic Location (Zv9):
Chromosome 10 (position 44736034)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 43429622
GRCz10 KN150172.1 5782
GRCz11 10 43258002
GRCz11 KN150172.1 5782
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGCCGGACAGCTTCTTCTCCACCGGTGAGGACTGTGTGGTCATGATCTG[G/A]CATGAGAGCGGACAGTGGAAMGATGTGCCCTGCAACTACCACCTGACCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa847
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012522 Essential Splice Site 1527 1570 13 14
ENSDART00000134304 Essential Splice Site 1526 1569 14 15
Genomic Location (Zv9):
Chromosome 10 (position 44737974)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 43431562
GRCz11 10 43259942
KASP Assay ID:
554-0750.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGCAGAGAAGACGGACAGTGGGACAAGCCCAAAATCACATGCTTGAATC[G/A]TAAGTTGTATGAGTTATTCTGTATAAYAAAACTAAAGCCATGAAAACAAT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link