
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
aif1l
- Ensembl ID:
- ENSDARG00000009336
- ZFIN ID:
- ZDB-GENE-030131-9646
- Description:
- allograft inflammatory factor 1-like [Source:RefSeq peptide;Acc:NP_942571]
- Human Orthologue:
- AIF1L
- Human Description:
- allograft inflammatory factor 1-like [Source:HGNC Symbol;Acc:28904]
- Mouse Orthologue:
- Aif1l
- Mouse Description:
- allograft inflammatory factor 1-like Gene [Source:MGI Symbol;Acc:MGI:1919598]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa11473 | Essential Splice Site | Available for shipment | Available now |
sa6989 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa11473
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- A > G
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000009500 | Essential Splice Site | 9 | 148 | None | 6 |
ENSDART00000139317 | None | 122 | None | 5 |
The following transcripts of ENSDARG00000009336 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 5 (position 36167652)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 33949601 GRCz11 5 34549754 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GGGTGAAGCCTCCAGACCGCTGAATAATTGCTCCCATGTCTCATTTTTCT[A/G]GGCGGAAAAGCCTTCGGGTTGCTCAAAGCTCAGCAGAGGGACAAGCTGGA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa6989
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > T
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000009500 | Essential Splice Site | 29 | 148 | 2 | 6 |
ENSDART00000139317 | None | 122 | None | 5 |
The following transcripts of ENSDARG00000009336 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 5 (position 36167716)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 33949665 GRCz11 5 34549818 - KASP Assay ID:
- 554-4480.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TCGGGTTGCTCAAAGCTCAGCAGAGGGACAAGCTGGAGGAAATCAATAAG[G/T]NNNNNTAAATGAGCGACCGCTGATGGATTATTATTGTCTCGATCTGGAGGCGAGT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: