smyd1a

Ensembl ID:
ENSDARG00000009280
ZFIN ID:
ZDB-GENE-030131-9825
Description:
SET and MYND domain containing 1 [Source:RefSeq peptide;Acc:NP_991103]
Human Orthologue:
SMYD1
Human Description:
SET and MYND domain containing 1 [Source:HGNC Symbol;Acc:20986]
Mouse Orthologue:
Smyd1
Mouse Description:
SET and MYND domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:104790]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40615 Nonsense Mutation detected in F1 DNA During 2018
sa31493 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa40615
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027811 Nonsense 169 485 3 11
Genomic Location (Zv9):
Chromosome 5 (position 75232849)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 71333990
GRCz11 5 72118496
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCTTCTACACCTACTGGCCTAAGAAAAGCAAAGCAGTGGGAGAGGATTA[T/A]GTGTCGCATCTCTTCGGTGTGGTAGGCACACATCCAACATGGACTTTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31493
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027811 Essential Splice Site 330 485 7 11
Genomic Location (Zv9):
Chromosome 5 (position 75228926)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 71330067
GRCz11 5 72114573
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCTCTGGTGAAGATTGAAGCGGCTCGAGCTCAAGGAAACTTCCATGAGG[T/G]GAGACTGAAGATGGATCTGCAGATGTGTGGATCTGGCAGCTGCAGTACAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link