zgc:136439

Ensembl ID:
ENSDARG00000009267
ZFIN ID:
ZDB-GENE-060421-2858
Description:
thymidylyltransferase [Source:RefSeq peptide;Acc:NP_001035462]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa21551 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21551
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019289 Nonsense 30 274 1 8
ENSDART00000141179 Nonsense 30 173 2 6

The following transcripts of ENSDARG00000009267 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 42153330)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 41278500
GRCz11 9 41080287
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACTGCAGCGGGATATTGAGATCGACACGACGGGGAAATTCAAGCATTTG[A/T]AAGGCATTGCCAAACCTCTGCTTCCCGTCGGTTCATGTGCACTGATCTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link